ID: 1004365412

View in Genome Browser
Species Human (GRCh38)
Location 6:15008647-15008669
Sequence CAGAGTTACCATTCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004365412_1004365421 17 Left 1004365412 6:15008647-15008669 CCACCCTCAGAATGGTAACTCTG No data
Right 1004365421 6:15008687-15008709 TGGCACACCGCGCTCTCCATAGG No data
1004365412_1004365415 -3 Left 1004365412 6:15008647-15008669 CCACCCTCAGAATGGTAACTCTG No data
Right 1004365415 6:15008667-15008689 CTGCCCACCGCTATCTACCCTGG No data
1004365412_1004365422 18 Left 1004365412 6:15008647-15008669 CCACCCTCAGAATGGTAACTCTG No data
Right 1004365422 6:15008688-15008710 GGCACACCGCGCTCTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004365412 Original CRISPR CAGAGTTACCATTCTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr