ID: 1004370634

View in Genome Browser
Species Human (GRCh38)
Location 6:15049300-15049322
Sequence CTGAAGCCTGCACTGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004370631_1004370634 2 Left 1004370631 6:15049275-15049297 CCTACTTCTCCAGGAGCCTGTTG No data
Right 1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG No data
1004370629_1004370634 13 Left 1004370629 6:15049264-15049286 CCTTTCACAAGCCTACTTCTCCA No data
Right 1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG No data
1004370632_1004370634 -7 Left 1004370632 6:15049284-15049306 CCAGGAGCCTGTTGCTCTGAAGC No data
Right 1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG No data
1004370628_1004370634 24 Left 1004370628 6:15049253-15049275 CCTGACACTTGCCTTTCACAAGC No data
Right 1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004370634 Original CRISPR CTGAAGCCTGCACTGTGATG AGG Intergenic
No off target data available for this crispr