ID: 1004373740

View in Genome Browser
Species Human (GRCh38)
Location 6:15074526-15074548
Sequence CTTAGAGCCTTCAGAACGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373740_1004373744 0 Left 1004373740 6:15074526-15074548 CCTCGCGTTCTGAAGGCTCTAAG No data
Right 1004373744 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG No data
1004373740_1004373750 22 Left 1004373740 6:15074526-15074548 CCTCGCGTTCTGAAGGCTCTAAG No data
Right 1004373750 6:15074571-15074593 GCACCAGCGACCAGTTTTGTGGG No data
1004373740_1004373749 21 Left 1004373740 6:15074526-15074548 CCTCGCGTTCTGAAGGCTCTAAG No data
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373740 Original CRISPR CTTAGAGCCTTCAGAACGCG AGG (reversed) Intergenic
No off target data available for this crispr