ID: 1004373743

View in Genome Browser
Species Human (GRCh38)
Location 6:15074549-15074571
Sequence CCAAAAAGGTTGGGGACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1107
Summary {0: 35, 1: 211, 2: 351, 3: 263, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373743_1004373753 20 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373753 6:15074592-15074614 GGAGATAATTTTTCCACAGATGG No data
1004373743_1004373749 -2 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data
1004373743_1004373757 28 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373757 6:15074600-15074622 TTTTTCCACAGATGGAGGGTGGG No data
1004373743_1004373754 23 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373754 6:15074595-15074617 GATAATTTTTCCACAGATGGAGG No data
1004373743_1004373756 27 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG No data
1004373743_1004373755 24 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373755 6:15074596-15074618 ATAATTTTTCCACAGATGGAGGG No data
1004373743_1004373758 29 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373758 6:15074601-15074623 TTTTCCACAGATGGAGGGTGGGG No data
1004373743_1004373759 30 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373743_1004373750 -1 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373750 6:15074571-15074593 GCACCAGCGACCAGTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373743 Original CRISPR CCAAAAAGGTTGGGGACCGC CGG (reversed) Intergenic
900587223 1:3439059-3439081 CTAAAAAGCGTGGGGACTGCTGG - Intergenic
900722850 1:4189004-4189026 CCAAAAAGGCTGGGGGTCGCTGG - Intergenic
901516777 1:9753031-9753053 CCAAAAAGGCTGGGGACTGCTGG - Intronic
901833530 1:11908775-11908797 CCAGAAAGGTTGGGGACCGCTGG + Intergenic
901863942 1:12091738-12091760 CCAAAAAGGTTGGGGACCACTGG - Intronic
902066525 1:13692794-13692816 CCCAAAAGGTTGAGGACCTCTGG - Intergenic
902221363 1:14967921-14967943 CCTAAAAGGTTGGGGACTGCTGG - Intronic
902365328 1:15969452-15969474 CCAAAAAGGTTGGGGGCTGCGGG + Intronic
903441649 1:23392818-23392840 CCAAAAATGTTGGGGACCACTGG - Intronic
903442964 1:23401994-23402016 CCAAAAAGGTTGGGGACTGGTGG + Intronic
903524862 1:23985923-23985945 CCAAAAAGGTTGGAGACTACTGG - Intergenic
903842092 1:26250482-26250504 ACAAAAAGGTTGGGAACCGCTGG + Intronic
904097491 1:27992202-27992224 CTGAAAAGGTTGAGGACTGCTGG - Intronic
904148236 1:28413111-28413133 CCAAAAAGGTTGGGGACCGCTGG + Intronic
904247448 1:29197947-29197969 CCAACAAGGTTAGGGACCGCTGG - Intronic
904288019 1:29466000-29466022 CCAAAGAGATTAGGGACCACTGG - Intergenic
904737766 1:32647954-32647976 CCAAAAAGGTTGGGGACCGCTGG + Intronic
905140783 1:35842373-35842395 CCAAAAAAGTTGAGGACTGCTGG + Intronic
906390486 1:45411262-45411284 CCAAAAAGGTTGGGGAAGGCTGG - Intronic
906639144 1:47431142-47431164 CCAAAAAGGTTGAGGACTCCTGG + Intergenic
906819453 1:48913837-48913859 CCAGAGAGGTTGGGGACTGCTGG + Intronic
906830913 1:49030742-49030764 CCAAAAAGGTTGGGGACCGTTGG + Intronic
906864057 1:49396883-49396905 CCAAAAAGGTTGGGGACCACTGG - Intronic
907087877 1:51694050-51694072 CCAAAAAGTCTGGGAACTGCTGG - Intronic
907819055 1:57949104-57949126 CCAAAAAGGTTGGGGACCGCTGG - Intronic
907885856 1:58591797-58591819 CCAGAAAGGTTGGGGAGGGAGGG + Intergenic
907911230 1:58828378-58828400 CCAAAAAGGTTGGAGGCCGCTGG + Intergenic
907977364 1:59444851-59444873 CCCAAAAGGCTGGGGACCGCTGG + Intronic
908155179 1:61345818-61345840 CCAAAAAGGTTGGGGACTTCTGG + Intronic
908309091 1:62857625-62857647 CCTGAAAGGTTGGGGACTGCTGG + Intronic
908439484 1:64139310-64139332 CCAACAAGTTTGGGAAACGCTGG - Intronic
909423106 1:75488293-75488315 CCAAAAAGGTTGGGGACCACTGG + Intronic
909447842 1:75767235-75767257 CCAAAAAGGTTGGGGATCACTGG + Intronic
909532987 1:76701715-76701737 ACAAAAAGGTTGGGGACTGCTGG - Intergenic
909701561 1:78530026-78530048 CCAAAAAGGTTGGGGACTGCTGG + Intronic
910265214 1:85331162-85331184 CCAGAAATGTTGGGAACTGCCGG - Intronic
910542851 1:88380727-88380749 CCAAAAAGTTTGGGGACCACTGG - Intergenic
911119582 1:94282217-94282239 CCAATAGGCTTGGGGACCACTGG + Intergenic
911588982 1:99724968-99724990 CCAAAAAGGTTGGGGACTGCTGG - Intronic
911625939 1:100124709-100124731 CCAAAAAGGTTGGGGGCCACTGG - Intronic
912750325 1:112282269-112282291 CCAAAAAGGATGGCGACTGCTGG - Intergenic
912909781 1:113745993-113746015 CCAAAAAGGTTGGGGACTGCTGG + Intronic
912913215 1:113784430-113784452 CCAAAAAGATTGGGGACCACTGG - Intronic
913325064 1:117620895-117620917 CCAAAAAGGTTGGGGACCACTGG + Intronic
913373063 1:118121692-118121714 CCAAAAAGGTTGGGGATCACTGG + Intronic
913570986 1:120119657-120119679 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
913598892 1:120404392-120404414 CAAAAAAGTTTGGAGACTGCTGG + Intergenic
913670601 1:121094433-121094455 CCAAAAAGGTTGGGGACCACTGG + Intronic
914022367 1:143881872-143881894 CCAAAAAGGTTGGGGACCACTGG + Intergenic
914088484 1:144475228-144475250 CAAAAAAGTTTGGAGACTGCTGG - Intergenic
914291794 1:146280633-146280655 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
914310128 1:146458982-146459004 CAAAAAAGTTTGGAGACTGCTGG + Intergenic
914319915 1:146549163-146549185 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
914552838 1:148731416-148731438 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
914591982 1:149114157-149114179 CAAAAAAGTTTGGAGACTGCTGG - Intergenic
914660850 1:149789813-149789835 CCAAAAAGGTTGGGGACCACTGG + Intronic
915955718 1:160218448-160218470 CCAAAAAGGTTGGGAAGAGGGGG + Intronic
916124423 1:161556725-161556747 CCAAAAATTTTGGAGACCACTGG - Intergenic
916134313 1:161638075-161638097 CCAAAAATTTTGGGGACCACTGG - Intronic
916308306 1:163364695-163364717 AAAAAAAGGATGGGGACCTCAGG - Intergenic
916333978 1:163649173-163649195 CTGAAAAGGTTGGGGACCCCTGG + Intergenic
916653395 1:166850864-166850886 CCAGAAAAGTTGGGGACTGCTGG + Exonic
916768009 1:167880445-167880467 TCAAAAGGGTCAGGGACCGCTGG + Intronic
917377042 1:174359924-174359946 CCAAAGAGGCTGGGAACCCCAGG - Intronic
917633307 1:176911012-176911034 CCAAAAAGGTGGGGGATCACTGG + Intronic
918016967 1:180644678-180644700 CCAAAAAGGTTGGGAACCACTGG - Intronic
918265157 1:182835775-182835797 CCAAATAGGTTGGGGACCGCTGG - Intergenic
918287607 1:183073068-183073090 CCAAAAAGGTTGGGGACTGCTGG + Intronic
918445652 1:184614505-184614527 CCAGAAAGGTTGGGGACTGCTGG - Intronic
918459032 1:184756569-184756591 CCAAAAAAGTTGGGGACTACTGG - Intergenic
918750891 1:188268254-188268276 CCAAAAAGGTTGGAGACGACTGG - Intergenic
919007798 1:191921820-191921842 TCAAAACGGTTGGGGACTGCTGG + Intergenic
919315121 1:195962793-195962815 CCAGAAAAGCTGGGGACCTCTGG - Intergenic
919682184 1:200446700-200446722 TCAAAAAGGTTGGGGACCACTGG - Intergenic
919852594 1:201683319-201683341 CCAAAAAGGGTGGGGATCGCCGG - Intronic
920374156 1:205498077-205498099 CCAAAAAGGTTAGGCGCCACTGG - Intergenic
920904944 1:210154444-210154466 CCAAAAAGGTTGGAGATCGCTGG + Intronic
921242069 1:213194906-213194928 CCAAAAAGGTTGGTGACTGCTGG + Intronic
921245651 1:213236247-213236269 CCAAAATGGTTGGGAACTGCTGG + Intronic
921322407 1:213954856-213954878 CCAAAAAGGTTGGGGATTGCTGG - Intergenic
921524962 1:216206288-216206310 CCAAAAAAGTTGGGGACCACTGG - Intronic
921715007 1:218408780-218408802 CCAAAAAGGCTGGGGACTGCTGG - Intronic
921988108 1:221334630-221334652 CCAAAAAGGTTGGGGACCACTGG - Intergenic
922328882 1:224556499-224556521 CCAAAAAGGTTGGGAATTGCTGG - Intronic
922501695 1:226101647-226101669 TCAAAAAGGTTGGAGACCTCTGG + Intergenic
922601891 1:226862503-226862525 CCAAGAAGGTTGAGGATTGCTGG + Intergenic
923027699 1:230219108-230219130 CCAAAAAGGTTGGGGACCGCTGG + Intronic
923289009 1:232526332-232526354 CCAAAAATGTTGGGGACCGCTGG - Intronic
923539907 1:234880852-234880874 CCAACAAGTCTGGGGACCACTGG - Intergenic
923891850 1:238224696-238224718 CCAAAAATGTTGGAGACTGCTGG - Intergenic
924893403 1:248308865-248308887 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
924895378 1:248332893-248332915 CCTAAAAGGTTGGGGACTGCTGG + Intergenic
1062827268 10:581872-581894 CCAAAAAGGCTGGGGACAGCTGG - Intronic
1063463646 10:6229740-6229762 CCAAAAAGGTCGGGGACTGCTGG - Intronic
1063956662 10:11273520-11273542 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1064112609 10:12551850-12551872 CCAAAAAGGTTGGGGACCATTGG + Intronic
1064265961 10:13825623-13825645 CCAAAAAGCTTGGGGATCACTGG + Intronic
1064280213 10:13944585-13944607 CCAAAAAAGTTGGGGACCACTGG + Intronic
1064368142 10:14726759-14726781 CCAAAAAGATTGGGGACCTCTGG - Intronic
1064562968 10:16610828-16610850 CCAAAAAGGCTGGAAACTGCTGG + Intronic
1064744004 10:18461496-18461518 CCAAAAAGGTTGGGGACCACTGG - Intronic
1064942142 10:20746817-20746839 CCAAAAAGGCTGGGGACAGCTGG + Intergenic
1064978465 10:21142918-21142940 CCAAAAAGGTTGGGGATGGCTGG + Intronic
1065123887 10:22554628-22554650 TCAGAAAGGTTGCTGACCGCTGG - Intronic
1065197217 10:23278256-23278278 CCAAAAAGGTTGAGAACCCCTGG + Intronic
1065755573 10:28927549-28927571 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1067160865 10:43824135-43824157 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1067492702 10:46726747-46726769 CCAAAGAGGTTGGGGACCACTGG + Intergenic
1067601964 10:47613648-47613670 CCAAAGAGGTTGGGGACCACTGG - Intergenic
1067736910 10:48862749-48862771 CCAAAAAAGTTGAGAACTGCTGG + Intronic
1068090592 10:52428461-52428483 CCAAAAAGGTAGGGGATGGCTGG - Intergenic
1068209098 10:53897071-53897093 CCAAAAAGGTTGGGGACCGCTGG + Intronic
1068250000 10:54426232-54426254 CCAAAGAGGTTGGGGACCACTGG - Intronic
1068574076 10:58663781-58663803 CCAAAAAGGTTGGAGATGGTTGG + Intronic
1068872120 10:61956410-61956432 CCAAAAAGTTTGGGGACCACTGG + Intronic
1069358354 10:67613787-67613809 CCAAAAAGGTTGGGGAACCGTGG - Intronic
1069372290 10:67761034-67761056 CCAAAAAGGTTAGCGACCACTGG + Intergenic
1069572359 10:69502034-69502056 CCAGAAAGGTTGGAGACCACTGG + Intronic
1069694945 10:70379795-70379817 CCGAAAAGGATGGGGACCGCTGG - Intronic
1070718380 10:78739169-78739191 CCAAAATGGTAGGGGACCAGTGG - Intergenic
1071136162 10:82457202-82457224 CCAAAAAGGTTGGGCATCATTGG - Intronic
1071653493 10:87421236-87421258 CCAAAGAGGTTGGGGACCACTGG - Intergenic
1072030106 10:91511485-91511507 CCAAAAAGGTTGAGGACTGATGG - Intronic
1072225023 10:93361038-93361060 ACAGAAAGGTTGGGGACCGCTGG - Intronic
1072353169 10:94578253-94578275 GCCAAAAGGTTGGGGACTACTGG - Intronic
1072793249 10:98334684-98334706 CCCAAAAGATTGGGCACCCCTGG + Intergenic
1072858956 10:98983065-98983087 CCAAACAGGTTGGGGACTGCTGG - Intronic
1072892799 10:99339698-99339720 CCAGAAAGGTTGGGGACCTCTGG + Intronic
1073199907 10:101727003-101727025 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1073642950 10:105271427-105271449 CCAGAAAGGTTGGGGACTGCTGG - Intergenic
1073682484 10:105719371-105719393 CCAAAAAGGCTGGGTTCTGCTGG - Intergenic
1073740328 10:106399142-106399164 CCAAAAAGTTTGGAGACCTCTGG + Intergenic
1074069602 10:110052597-110052619 CCAAAAAAGTTGGGGACCGATGG + Intronic
1074653220 10:115548921-115548943 CCAAAAGGGTTGGGAACCAAAGG + Intronic
1074934654 10:118165916-118165938 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1075237382 10:120742974-120742996 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1075307814 10:121383403-121383425 TCATAAAGGTTGGGGACTGCTGG - Intergenic
1075484627 10:122812231-122812253 TCAAAAAGGTTGGGGACCACTGG + Intergenic
1075566013 10:123504889-123504911 CCAACATGGTGGGGGACCTCTGG + Intergenic
1075655754 10:124160085-124160107 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
1075996253 10:126878600-126878622 CCCAAAAGGCTGGGGACCGCTGG - Intergenic
1076415085 10:130280273-130280295 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
1078492947 11:11786093-11786115 CCAAAGAGGTTGGGGACTGCTGG + Intergenic
1078571780 11:12464832-12464854 CCAAAAAGGTTGGGGACTACTGG - Intronic
1078630780 11:13001808-13001830 TCAAAAATGTTGGGGGCCACTGG + Intergenic
1078849549 11:15151369-15151391 CCAACAAGGTTAGGGACTGCTGG + Intronic
1078943784 11:16039896-16039918 CCAAAAAAGTTGAGAACAGCTGG + Intronic
1079531929 11:21464601-21464623 CACAAAATGTTGGGGACCACTGG + Intronic
1079665828 11:23104286-23104308 CCAAAAAGGTTGGGGGCCACAGG - Intergenic
1080066445 11:28020554-28020576 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1080181615 11:29432414-29432436 CAGAAAAGGTTGGGGACTGCTGG + Intergenic
1080190872 11:29546982-29547004 CCCAAAAGTTTGGGGATTGCTGG + Intergenic
1080242860 11:30147184-30147206 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1080722799 11:34866311-34866333 CCAAAAAGATTGGGGACCACTGG + Intronic
1080878516 11:36298200-36298222 CCAAAAAAATTGGGGACTGCTGG - Intronic
1080926456 11:36761563-36761585 CCAAAAAGGTTGGGGATCACTGG + Intergenic
1082769943 11:57200046-57200068 ACAAAAAGGTTGGGGACTGCTGG + Intergenic
1083486840 11:62988466-62988488 ACAAACAGCTTGGGGACTGCGGG + Intergenic
1084455742 11:69267330-69267352 CCAAAAAGGTTGGGAACCGCTGG + Intergenic
1086470613 11:87105498-87105520 CCAAAAAAGTTGGGGACCGCTGG + Intronic
1086848374 11:91779860-91779882 CCAAGAAGGTTGGGGACTGCTGG - Intergenic
1086993071 11:93327606-93327628 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1087160382 11:94942837-94942859 CCAAAGAGGTTGGGTACCACTGG - Intergenic
1087161592 11:94953515-94953537 CAAAAAAGGTTGGGGGCAGTGGG - Intergenic
1087343751 11:96942803-96942825 CCACAAAGGTTGGGGGCTGCTGG - Intergenic
1087459705 11:98430317-98430339 CTAAAAGGGTTGGAGACTGCTGG + Intergenic
1087656451 11:100929058-100929080 CCAAAAAGGTTGGGGACCGCTGG - Intronic
1087672039 11:101118924-101118946 CCAAAAAGGTTGAGGACTGCTGG - Intronic
1088341499 11:108772882-108772904 CCAAAAAGGTTGGGCATTGTTGG + Intronic
1088615062 11:111618059-111618081 CCAAAAAAGTTGGGCACCACTGG - Intronic
1088650513 11:111953983-111954005 CCAGAAAGGTTGGGGACCTCTGG - Intronic
1088939193 11:114436602-114436624 CCAAAAATGTTGGGGACCACTGG - Intronic
1089052673 11:115559216-115559238 CCAGAAAGGTTGGTGACCGCTGG + Intergenic
1089151165 11:116365511-116365533 GCCAAAAAGTTGGGGACCACTGG + Intergenic
1089281382 11:117377131-117377153 CCAAAAAGGTTGGGGACCGCTGG - Intronic
1091536353 12:1413870-1413892 CCAGAAAGGTTGGGGACTGCTGG - Intronic
1091550354 12:1531151-1531173 CGAACAAAGCTGGGGACCGCCGG + Intronic
1091858124 12:3755450-3755472 CCAAAAAGGTTGGGGACCTCTGG - Intronic
1092283101 12:7112231-7112253 CCAAAAAGGGTGGGGACTGCTGG + Intergenic
1092292123 12:7166650-7166672 CCAAAAAGGTTGGTGACCACTGG + Intergenic
1092619780 12:10251470-10251492 CCAAAAAGTTTGGGGACCACTGG - Intergenic
1093104465 12:15069150-15069172 CCAAAAAGGTTGGGGACCAATGG + Intergenic
1093165788 12:15803527-15803549 CCAAAACGGTTGGGGACCTCTGG - Intronic
1093176350 12:15917678-15917700 CCAAAAAGGTCCGGGACCGTTGG - Intronic
1093713140 12:22350624-22350646 CTAAAAAGGTTGGGGACTGCTGG + Intronic
1093714154 12:22362336-22362358 CCAAAAAGGTTGGGGACCACTGG + Intronic
1093746615 12:22749634-22749656 CTGGAAAGGTTGGGGACCACTGG - Intergenic
1093886630 12:24468880-24468902 CCAAAAAGGTTGGATACTGCTGG - Intergenic
1094167457 12:27457092-27457114 CCAAAACGGTTGGGGACCACTGG + Intergenic
1094416010 12:30215833-30215855 CCAGAAAGGTTGGGGACGACTGG - Intergenic
1094546832 12:31412336-31412358 CCAAAAAGGTTGGGAACCACTGG - Intronic
1094673479 12:32594616-32594638 CCAAAAAGGTTGGGGACCTCTGG + Intronic
1095149734 12:38778231-38778253 CCAAAAAGGTTGGGGACTTCTGG + Intronic
1095184382 12:39184772-39184794 CCAAAAGGATTGGAGACCACTGG + Intergenic
1095440216 12:42231049-42231071 CCAAAAAGTTTGTGAACTGCTGG - Intronic
1095654370 12:44651226-44651248 CCAAAAAGATTGGGGATCACTGG + Intronic
1095697678 12:45159187-45159209 CCAAAAATGTTGAGGATTGCTGG - Intergenic
1096243556 12:49972306-49972328 CCAAGAAGGGAGGGGAGCGCGGG + Intronic
1096794227 12:54064452-54064474 CCAAAAAGTTTGAGAACCACTGG - Intergenic
1097308098 12:58090991-58091013 TCAAAAAAGTTGGGGACTGCTGG - Intergenic
1097897221 12:64837201-64837223 CCAAAAAGGTTGGGGACCACTGG - Intronic
1098520811 12:71433283-71433305 CCAGAAAGGCTGGGGATCACTGG + Intronic
1099028106 12:77491294-77491316 CCAAAAAGGTTGGGGATTGCTGG + Intergenic
1099200282 12:79668458-79668480 CCAAAAAGGCTGGGAACCACTGG - Intronic
1099338660 12:81398172-81398194 CCAAAAACTTTGGGGACCATTGG + Intronic
1099703940 12:86126811-86126833 CCAAAAAGTTTGGGGACCCCTGG - Intronic
1099871645 12:88356687-88356709 CCAAAAAGTTTGGGGACCGCAGG + Intergenic
1099974657 12:89533883-89533905 CCATAAAGGTTGGGGACTTTAGG - Intergenic
1100324802 12:93530900-93530922 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
1100341550 12:93684205-93684227 CCAAAAAGGCTGGGGACCTCTGG - Intronic
1100456823 12:94759842-94759864 CCAAAAAGGTTGAGGACTGCTGG - Intergenic
1100715627 12:97302435-97302457 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1100716141 12:97307902-97307924 CCAAAAAGCTTGAGAACCACTGG + Intergenic
1101159190 12:101956071-101956093 CCAAAATGCTTGGGGACCACTGG - Intronic
1101749072 12:107567894-107567916 CCAAAAAGATTGGGGACGGTTGG + Intronic
1101917189 12:108904677-108904699 CCAAAAAGGTTGGGGACACCTGG + Intergenic
1101931471 12:109017412-109017434 CCAAAAAAGTTGGGGACTGCTGG + Intronic
1103408285 12:120691512-120691534 CCAAAAAGGAAGGGGGCCGAAGG - Intronic
1103703403 12:122859341-122859363 GGAAAGAGGTTGGGGACCACAGG - Intronic
1103980147 12:124731877-124731899 CCAAAAAGGCTGGGGACTGCTGG + Intergenic
1104361292 12:128135570-128135592 CCAAAAAGGGTGGGGACCGCTGG + Intergenic
1104722175 12:131050687-131050709 CCAAAATGTCTGGGGACCGCTGG - Intronic
1105825126 13:24115624-24115646 CCAAAAAGGTTGGAGACTGCTGG + Intronic
1105913178 13:24890312-24890334 CTAAAAAGGTTGGGAGCGGCGGG + Intronic
1106065887 13:26348635-26348657 CCAAAAAGGTTGGGAACCGCTGG + Intronic
1106066318 13:26354788-26354810 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1106474321 13:30084352-30084374 CAAAAAAGGTTGTAGACCACTGG + Intergenic
1106639048 13:31563618-31563640 CCAAAAAGGTTGGAGACCACTGG + Intergenic
1106939882 13:34766419-34766441 CCAAAAATTTTGGGGACTGCTGG + Intergenic
1106975336 13:35204630-35204652 CCAAAAGCTTTGGGGACCACTGG + Intronic
1107048943 13:36027117-36027139 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1107067085 13:36226233-36226255 TCAAAAGGGTTGGGAACTGCTGG - Intronic
1107221523 13:37986782-37986804 CCAAAAGGGTTGAGGATCGCTGG + Intergenic
1107573990 13:41697443-41697465 CCAAAAAGGTTGGGGGCCACTGG - Intronic
1107593595 13:41937154-41937176 TCAAAAAGGTTGGTGACTGCTGG - Intronic
1108333309 13:49412639-49412661 CGAAAAAGGTTGGGGACTGCTGG - Intronic
1108435008 13:50393413-50393435 CCAAAAACATTGGGGACTGCTGG - Intronic
1108583498 13:51847476-51847498 CCAAAAAGATTGGGGACCACTGG + Intergenic
1108914927 13:55596166-55596188 CCAAAAAGGTAGGGGAACTCTGG - Intergenic
1109140928 13:58713596-58713618 ACAAAAAGGGAGGGGACCTCAGG - Intergenic
1109317413 13:60766719-60766741 CCAAAAAAGTTGGGGACTGCTGG - Intergenic
1109818783 13:67623735-67623757 CCAAGAAGGTTGAGGACTGCTGG + Intergenic
1109904160 13:68816551-68816573 CCAAAAAGGTCAGGGACTGCTGG - Intergenic
1109990469 13:70048509-70048531 TCAAAAAGTTTGGAGACTGCTGG - Intronic
1110077664 13:71269410-71269432 GCAAAAAGGTTGGGGACCGCTGG - Intergenic
1110206975 13:72926207-72926229 TCAAAAAGTTTGGAGACCACTGG - Intronic
1110762992 13:79251392-79251414 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1110780975 13:79464686-79464708 CCTAAAAGGTTGGAGACTGCTGG - Intergenic
1111320951 13:86628308-86628330 CAAAAAAGGTTGGGGAATGCTGG - Intergenic
1111694134 13:91601925-91601947 CCAAAAAGGTTGAGGAGTGCTGG + Intronic
1111753498 13:92363322-92363344 CCAAAAATGTTGGGGACCTCTGG - Intronic
1111793310 13:92885841-92885863 CCAAAAAGGTTGGGGACCAATGG + Intergenic
1111885828 13:94018989-94019011 CCAAAAGGGTTGGAGACTGCTGG + Intronic
1111924394 13:94447196-94447218 CCAAAAAGGTTGGGGACCGGTGG - Intronic
1112615997 13:101006231-101006253 CCAAAAAGGTTGAGGACCACTGG - Intergenic
1112922274 13:104628278-104628300 TCAGAAAGGTTGGGGACCACTGG + Intergenic
1113783543 13:112989812-112989834 CCAGAAAGATTGGGGACTGCTGG - Intronic
1114333290 14:21660051-21660073 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1114400264 14:22403595-22403617 CCAAGAAGGTCTGAGACCGCAGG + Intergenic
1114656794 14:24320934-24320956 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1114988929 14:28263590-28263612 CCATAAATGCTGGGGACTGCTGG - Intergenic
1115053310 14:29091438-29091460 TCAAAAAGTTTGGGGACTACTGG + Intergenic
1115251959 14:31358178-31358200 CCTAAAAGGTTGGGGACCACTGG + Intronic
1115332093 14:32208653-32208675 CAAAAAAAGTTGGAGACTGCTGG + Intergenic
1116250795 14:42481041-42481063 CCAAAAAGTTTGGGGACCACTGG - Intergenic
1116255585 14:42549943-42549965 CTAAAAAGGTTGGGGACTGCTGG + Intergenic
1116873420 14:50089235-50089257 TCAAAAAGGTTGGGGACTGCTGG - Intronic
1116966126 14:51016764-51016786 CCAAAGAGGCTGGGGACCAGTGG + Intronic
1117161529 14:52994792-52994814 CCAAAAAGAGTGGGGACTGCTGG - Intergenic
1117432237 14:55678943-55678965 CCAAAACGGTTGGGTATTGCTGG + Intronic
1117493367 14:56275266-56275288 CCAAAATGGCTGGGGACTGCTGG - Intronic
1117575028 14:57088989-57089011 TCCAAAAGATTGGGGACCTCTGG + Intergenic
1117630902 14:57690467-57690489 CCAAAAAGATTGGGGACTGCTGG - Intronic
1118187962 14:63554727-63554749 CCAGAAAGGTTGTGGACTGCTGG - Intergenic
1118370077 14:65130411-65130433 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1118676032 14:68185603-68185625 AAAAAAAGGTTGGGGACCATAGG - Intronic
1118837999 14:69490174-69490196 CCAAAAACGTTGGGGACTGCTGG - Intronic
1119062139 14:71485781-71485803 CCAAAAAGATTGGGGACCGCTGG + Intronic
1119203768 14:72778653-72778675 CCAGAAAGGTTGGGGACTTCCGG + Intronic
1119260326 14:73234502-73234524 CCAAAAAGGTCGGGTACCACTGG - Intergenic
1119679442 14:76581017-76581039 AGAAAAAGTTTGGGGACCCCTGG - Intergenic
1119882405 14:78111203-78111225 CCAAAAATGTTGGAGACTGCTGG + Intergenic
1119907320 14:78317588-78317610 CCAAAGAGGTTGAGGACTTCTGG + Intronic
1120685715 14:87534124-87534146 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1121051461 14:90821510-90821532 CCAAAAAGCTTGGAGACCTCTGG - Intergenic
1121148263 14:91605581-91605603 CGAAAGAGTTTGGGGACAGCAGG - Intronic
1121270811 14:92637005-92637027 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1121284982 14:92728131-92728153 CCAAAAAGGTCGTGGACCGCTGG - Intronic
1121290620 14:92771929-92771951 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
1121539808 14:94716987-94717009 CCAAAAAGGTTGGGGACCCCTGG + Intergenic
1121958573 14:98237767-98237789 CCAAAAAGGTTGGGGATCACTGG - Intergenic
1121976455 14:98408563-98408585 CCAAAAAGGATGGGGAAGGCAGG + Intergenic
1122183984 14:99975490-99975512 CCAAAAAAGTTGTGAACTGCTGG - Intronic
1122334695 14:100963741-100963763 CCAAAAATGTTGGGGACCATTGG + Intergenic
1122759260 14:104009388-104009410 CTAAAAAGGTTAGGGATCACTGG + Intronic
1123106903 14:105846001-105846023 CCAGAGAGGTTGGGGGCAGCAGG - Intergenic
1123208379 14:106735885-106735907 GCAAAAAGGTTGGGGACCACTGG - Intergenic
1123481682 15:20638344-20638366 CCAAAAATGTTGGGGACCACTGG - Intergenic
1123636331 15:22362021-22362043 CCAAAAATGTTGGGGACCACTGG + Intergenic
1124203722 15:27699629-27699651 CCAATAAGGATGGGGACCAGGGG + Intergenic
1124450067 15:29780063-29780085 CCAAAGAGGTTGAGGACTGCTGG - Intronic
1124484992 15:30105748-30105770 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
1124518586 15:30391521-30391543 CCAAAAAGTTTGGGGACTGCTGG - Intronic
1124540067 15:30574727-30574749 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
1124758583 15:32432850-32432872 CCAAAAAGTTTGGGGACTGCTGG - Intergenic
1124940869 15:34216815-34216837 CCAAAAATGTTCAGGACCACTGG - Intergenic
1125319933 15:38475137-38475159 CCAAAAAGGTTGGGAACTGCTGG - Intronic
1125860783 15:42997475-42997497 CCAAAAAGGTTGGGGACCATTGG + Intronic
1127099496 15:55550867-55550889 TCAAAAAGGTTGGGGATCACTGG - Intronic
1127149047 15:56054993-56055015 CCAAAAAGGTTGGGGATAGCTGG - Intergenic
1127169223 15:56281607-56281629 CCAAAAAGTTTGGGGACCACTGG + Intronic
1127320055 15:57835548-57835570 CCATGAAGGTTGGGGACCACTGG - Intergenic
1127398050 15:58558748-58558770 CCCAAAATGTTGGGGACTGCTGG + Intronic
1127448508 15:59091711-59091733 TCAAAAAGGTTGGGGACCGTTGG - Intronic
1127550816 15:60036747-60036769 CCAAATATGTTGGGGACTGCTGG - Intronic
1127876928 15:63119737-63119759 CCAAAAAAGCTGGGAACCGCTGG - Intergenic
1128010775 15:64293907-64293929 CCAAAAAAGTTGGGGACTGCAGG + Intronic
1128420620 15:67488593-67488615 CCAAAAAGGTTGGGGATTGCTGG - Intronic
1129344553 15:74908428-74908450 CCAAAAAGGCTGGAGACTGCTGG - Intergenic
1130195707 15:81778520-81778542 GCCAAAAGGTTGGGGACTTCTGG + Intergenic
1130443418 15:83977313-83977335 CCAGAAAGGTTGGGGACTGCTGG + Intronic
1130629673 15:85554004-85554026 CGAAAAATGCTGGGGACCGCTGG + Intronic
1130743123 15:86622675-86622697 CCAAAATGGTTGAGGATTGCTGG - Intronic
1130918847 15:88327284-88327306 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1131159008 15:90092286-90092308 CCAAAAACTTTGGGAACTGCTGG + Intronic
1131407304 15:92175858-92175880 CCAGAAAGGTTAGGGACCGCTGG + Intergenic
1131565784 15:93484175-93484197 CCAAAAAGGTTGAGGATCATTGG - Intergenic
1131729330 15:95262636-95262658 CCAAAAAGGGTGAGAACCTCAGG + Intergenic
1132032134 15:98446902-98446924 CCAAAAAGGTTGGGGACCACTGG + Intronic
1132730780 16:1360742-1360764 CCAAAAAGATTGGGGACCACTGG + Intronic
1133581778 16:7151526-7151548 CCAAAAAGGTTGGGGAGTGCTGG - Intronic
1133603390 16:7361629-7361651 CCAAACAGGTGGGAGACAGCAGG + Intronic
1133977324 16:10608541-10608563 CCAAAAAGGTTGAGGACCACTGG + Intergenic
1134639623 16:15819805-15819827 TCAAAAAGGTTGGGGACTGCTGG + Intronic
1135042222 16:19126421-19126443 GCCAAAAAGTTGGGGACTGCTGG + Intronic
1135277608 16:21127116-21127138 CCAAAATGGGTGGGGACCGCTGG + Intronic
1135284617 16:21182650-21182672 CCAAAAAGGTTGAGGACCACTGG + Intergenic
1136060988 16:27726297-27726319 CCCAAAAGGTTGGGGACCGCTGG + Intronic
1136390152 16:29959069-29959091 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1137325548 16:47431528-47431550 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1138425499 16:56929448-56929470 TCAAAAAGGTTGGGAACTCCTGG - Intergenic
1138508144 16:57489072-57489094 GCCAAAAAGTTGGGGACCACTGG - Intergenic
1138523724 16:57589411-57589433 CCCAAAAGGTTGGGGATCACTGG + Intronic
1138694260 16:58796914-58796936 CCAAAAAGAGTGGGGACTGCTGG + Intergenic
1138774834 16:59708900-59708922 CCAAAAAGGTTGGAGACTGCTGG - Intergenic
1138914526 16:61447335-61447357 CCAAAAAGGTAGGGGAATGCTGG - Intergenic
1138964712 16:62070507-62070529 CCAAAAAGGCTGAGGACTGCTGG - Intergenic
1139120394 16:64009336-64009358 GCAAAAATGTTGGGGACCACTGG - Intergenic
1139144617 16:64308558-64308580 CCAAAAACGTTGGGGACTTCTGG + Intergenic
1139305907 16:65986209-65986231 CCAAAAAGGTTAGGGACTGCTGG + Intergenic
1139375032 16:66491578-66491600 CCAAAAAGGTTGGGGACCGCTGG - Intronic
1140013611 16:71160914-71160936 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1140358605 16:74326346-74326368 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1140910644 16:79448812-79448834 CCAAAAAGTTTGGGGAATGCTGG - Intergenic
1140919700 16:79526162-79526184 CCAAAAAGATTGGGGACTGCTGG - Intergenic
1141991018 16:87609777-87609799 CCAAAAAGGTTGGGGACCATTGG - Intronic
1142435092 16:90051556-90051578 CCAAAAAGTTTGGGGACACCTGG + Intergenic
1142534846 17:606924-606946 CCAAAAAGGTTGGGGACAGCTGG + Intronic
1142542147 17:668048-668070 CCAAAAAGGTTGGGGACCACTGG + Intronic
1142777235 17:2150349-2150371 CCAAAAAGGTTGGGGACCACCGG + Intronic
1143203093 17:5125429-5125451 GCAAAAAGGTTGGGAACCACTGG + Intronic
1143279463 17:5741759-5741781 CCAAAAAGGTTGGGGATCGCTGG - Intergenic
1144427823 17:15161130-15161152 CCAAGAAGGTTGGGGACTGCTGG - Intergenic
1145009756 17:19361339-19361361 CCAAAAAGGTTGAGGACCACTGG + Intronic
1145277969 17:21446879-21446901 CCAAAAAGGTTGTGGACTGCTGG - Intergenic
1145315793 17:21732750-21732772 CCAAAAAGGTTGTGGACTGCTGG - Intergenic
1145714220 17:27004680-27004702 CCAAAAAGGTTGTGGACTGCTGG - Intergenic
1145834659 17:27945216-27945238 TCAAACAGGTTGGGGACTGCTGG - Intergenic
1146159063 17:30549772-30549794 CCAAAAAGGTTGGGGACCACCGG + Intergenic
1146168433 17:30612088-30612110 CCAAAAAGGTCGGGGAGTGCTGG - Intergenic
1146221399 17:31025588-31025610 CCAAAAAGGTCGGGGAGTGCTGG - Intergenic
1146315987 17:31807137-31807159 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1146845698 17:36180773-36180795 CCAAAAAGTTTGGGGACCGCTGG - Intronic
1146873916 17:36392650-36392672 CCAAAACGTTTGGGGACCGCTGG - Intronic
1146881268 17:36443562-36443584 CCAAAACGTTTGGGGACCGCTGG - Intergenic
1147065474 17:37920223-37920245 CCAAAACGTTTGGGGACCGCTGG + Intergenic
1147230292 17:39012669-39012691 CTAAAAAGGTTGGGGACCACTGG - Intergenic
1147538574 17:41336707-41336729 CCAAAAAGGCTGGGGACCACTGG - Intergenic
1148169870 17:45509859-45509881 CCGAAAGGGCTGGGGACAGCAGG + Intergenic
1148279339 17:46335949-46335971 CCGAAAGGGCTGGGGACAGCAGG - Intronic
1148301556 17:46553804-46553826 CCGAAAGGGCTGGGGACAGCAGG - Intronic
1148365489 17:47052806-47052828 CCAAAAGGGCTGGGGACAGCAGG - Intergenic
1149002047 17:51767522-51767544 CCAAAAAGGTGGGGGATCACTGG - Intronic
1149270973 17:54976867-54976889 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1149284474 17:55147162-55147184 CCAAAAAGGTTGGGAACTGCTGG - Intronic
1149391665 17:56197783-56197805 CAAGAAAGGTTGGGGACTGCTGG - Intronic
1149588301 17:57808387-57808409 GCACAAAGGTTGGGGACCACTGG + Intergenic
1149848897 17:60023717-60023739 GCAAAAAGGTTGGGAACCGCTGG - Intergenic
1149861271 17:60122807-60122829 GCAAAAAGGTTGGGAACCGCTGG + Intergenic
1150119944 17:62592616-62592638 CCAAAAAGGCTGGAAACCACTGG - Intronic
1150366401 17:64589919-64589941 CCAAAAATGGTGGGGTGCGCTGG + Intronic
1150400951 17:64855457-64855479 CCGAAAGGGCTGGGGACAGCAGG + Intronic
1150455813 17:65305581-65305603 CCAAAAAGGCTGGGGACTGCTGG - Intergenic
1150527867 17:65942356-65942378 CCAAAAAGGTTGGGTACTGCTGG + Intronic
1151026771 17:70686067-70686089 CCAAAAAGGTTGGAGACCACTGG + Intergenic
1151175185 17:72282167-72282189 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1151199197 17:72455342-72455364 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
1151230613 17:72682351-72682373 CCAAAAAGGTTGGAGACTGCTGG + Intronic
1151275750 17:73032958-73032980 CCCAAAGGATTGGGGACCGCTGG - Intronic
1151636790 17:75354646-75354668 GCAAAAAGGTTGGGGACTGCTGG + Intronic
1151795321 17:76340963-76340985 CCAAAAAGGTTGGAGACTGCTGG + Intronic
1151881152 17:76895447-76895469 CTAAAAAGGTTGGGAACCACTGG + Intronic
1152155950 17:78632825-78632847 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1152417928 17:80175099-80175121 CCAAGTAGCTTGGGGACCACAGG + Intronic
1153246950 18:3081925-3081947 CCAAAAAGGTTGGGGACCACTGG - Intronic
1153342269 18:3987885-3987907 CCAAAAAGGTTGGGCACCACTGG - Intronic
1153386635 18:4504955-4504977 CCAAAACGGTTGGCGATCACTGG + Intergenic
1153728652 18:7983401-7983423 CCAAAAAGTTTGGGGCCTGTTGG + Intronic
1153955466 18:10092113-10092135 CCAAAAAAGTTAAGGACCACTGG + Intergenic
1153956328 18:10099563-10099585 CCAAAAAGTTTGGGGATTGCTGG - Intergenic
1155107954 18:22686474-22686496 CCAATAAGGTTGGGAACCACTGG - Intergenic
1155158261 18:23176160-23176182 CAAAAAAGGTTGGGGACCACTGG - Intronic
1155459954 18:26067801-26067823 CCAAAAAGGTTGGGGACCACTGG - Intronic
1156083929 18:33376404-33376426 CCAAACAGATTGGGGACAGAGGG - Intronic
1156623093 18:38875787-38875809 CCAAAAACCTTGGGGACCTCTGG + Intergenic
1157375609 18:47161638-47161660 CCACAAAGGTTGGGGACTGCTGG - Intronic
1157449888 18:47777965-47777987 CTAGAAAGGTTGGGGACCGCTGG - Intergenic
1157513864 18:48297090-48297112 CCAAAAAGGTTAGGGGCTGCTGG + Intronic
1157778080 18:50412577-50412599 CCAAAAAGGTTGGGGACCATTGG - Intergenic
1157780302 18:50432441-50432463 CCAAAAAGGTTAGGGACCAATGG + Intergenic
1157808596 18:50677234-50677256 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1158289490 18:55923336-55923358 CCAAAAATGTTGGAGACCGCTGG - Intergenic
1158440342 18:57469528-57469550 CCTAAAAGGTTTTGGACCACTGG - Intronic
1158480917 18:57821109-57821131 CCAAAAAGACTGGGGACTGCTGG + Intergenic
1158522081 18:58179974-58179996 CCAAAAAAGTTGGGGACCGTTGG + Intronic
1158568338 18:58574735-58574757 CCAAAATGTTTGGGGACTGCTGG + Intronic
1158896889 18:61922447-61922469 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1158940888 18:62405248-62405270 CCAAAAAGGTTGGGGACCACAGG - Intergenic
1159703144 18:71654886-71654908 CCAAAAAATTTGGGGACCCCTGG + Intergenic
1159883803 18:73885162-73885184 CCAAAAAGTTTGAGAACCGCTGG - Intergenic
1159937259 18:74379191-74379213 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1160217019 18:76941113-76941135 CCAAAAAGGGTGGGGACTGCTGG + Intronic
1160245765 18:77158380-77158402 CCAAAATGGTTGGGGACCACTGG - Intergenic
1160412163 18:78682481-78682503 CCAAAAAGGTTGGGGGCCGCTGG + Intergenic
1161930365 19:7335711-7335733 CCAAAAAGGTTGAGGATCTCTGG - Intergenic
1162254023 19:9472857-9472879 CCAAAAAGGCTGGGGACTGCTGG + Intronic
1162684437 19:12369993-12370015 CCAAAAAGGTTAGGAACTGCTGG - Intergenic
1163010603 19:14423254-14423276 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1163616884 19:18334487-18334509 CCAAAAAGATTGGGGACTGCTGG + Intergenic
1164579724 19:29427233-29427255 CCAAATAGATTAGGGACCACTGG + Intergenic
1164710814 19:30355936-30355958 CCAAAAAGCCTGCGGACAGCTGG + Intronic
1165402669 19:35611918-35611940 CTCAAAAGGTTGGGGACTGCTGG + Intergenic
1165410394 19:35656993-35657015 CCAAAAAGGGTGAGGACCACTGG - Intronic
1165675427 19:37718816-37718838 CCAAGAAGGTTAGGGATCACTGG - Intronic
1166548865 19:43651770-43651792 CCAAAAAGTTTGAGAACCACTGG + Intronic
1166596007 19:44051092-44051114 CTAAAACGGTTGGGGACCACTGG - Intergenic
1166607975 19:44162308-44162330 CCAAAAAGGTTGTGAACTGCTGG + Intergenic
1167223138 19:48216743-48216765 CCAAAAAGGTTGGGGACCACTGG - Intronic
1167468035 19:49660496-49660518 CCAAATAGTTTGGGGGCCACTGG + Intronic
924989026 2:295393-295415 CCAAAAGGGTTTGGGGCCGTAGG + Intergenic
925241644 2:2336057-2336079 CCAAAAAGGTTGGGTACTGCTGG + Intergenic
925529265 2:4841750-4841772 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
925557794 2:5151783-5151805 CCAAAAAAGTTGAGGACTGCTGG - Intergenic
926182116 2:10653668-10653690 CCAAAAAGGATGGGCACAGAGGG - Intronic
926286533 2:11493242-11493264 CCAAAAAGGTTGGGGGCTGCTGG - Intergenic
926324392 2:11771791-11771813 CCAAAAAGGTTGGGGACCACTGG - Intronic
926526432 2:13987123-13987145 CCAAAAAGGTCGGGGACATTAGG - Intergenic
926526441 2:13987158-13987180 CCAAAAAGGTTGGGAACATTAGG - Intergenic
926598532 2:14816471-14816493 CCAAAAAGGTTGGAGACTGCTGG + Intergenic
927132205 2:20070310-20070332 CCAGGAAGGTTGGGGTCTGCTGG - Intergenic
927355070 2:22163702-22163724 CCAAACAGGTTGGAAACCGCTGG - Intergenic
927507808 2:23626022-23626044 CCAAAAACGTTGGGGACCACTGG - Intronic
927530488 2:23793799-23793821 CCAAAAAGTTTGTGCACCTCTGG - Intronic
927817569 2:26232900-26232922 TCAAAAAGGTTGGGGACTGCTGG - Intronic
928344339 2:30476793-30476815 CCAAAAAGGCTGGGGACTGCTGG + Intronic
928559461 2:32464117-32464139 TCAAAAAGGTTGAGGACCGCTGG + Intronic
928716794 2:34070860-34070882 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
928716809 2:34070949-34070971 CCAAAAAGGTTGAGGACCACTGG - Intergenic
928930531 2:36619365-36619387 CCAAAAATATTGGGGACTGCTGG + Intronic
928994420 2:37271803-37271825 CCAAAAAGGTTAGGGACTGCTGG + Intronic
929104028 2:38346487-38346509 CCAAGAAGGTTGGGGACCGCTGG - Intronic
929184523 2:39079857-39079879 CCAAGAAGGTTGGAGACTGCTGG - Intronic
929249945 2:39742217-39742239 ACATAAAGGTTGGGGACAGGTGG + Intronic
929286973 2:40146439-40146461 CCAAAAAGTTTGGAGACCACTGG - Intronic
929390321 2:41461860-41461882 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
929476087 2:42250670-42250692 CCAAAAAAGTTGGTGACCACTGG - Intronic
930026509 2:47032291-47032313 TCAAAAAGGTTGAGGAGCCCTGG + Intronic
930129457 2:47834357-47834379 CAAAAAAGGTTGGGGGGGGCGGG + Intronic
930591183 2:53328378-53328400 CCAAAAAGGTTGAGAACTGCTGG - Intergenic
930649732 2:53952649-53952671 CCAAAAAGGTTGGGGACTGCTGG - Intronic
930797965 2:55412675-55412697 CCAAAAAGGTTGGGGACCGCTGG + Intronic
930897404 2:56462287-56462309 CCAAAAAGGTTGGGGGCTGCTGG - Intergenic
930935914 2:56951364-56951386 CCAAAAAGGTTGGAGACTGCTGG - Intergenic
931389935 2:61832883-61832905 CCAAAAAGGTTGAGGACTGCTGG + Intronic
931542234 2:63341980-63342002 TCAAAAAAGTTGGGGACCACTGG - Intronic
932278398 2:70468973-70468995 TCAAAAAGGTTGGGGGCTGCTGG + Intronic
932605167 2:73160515-73160537 GCCAAAAGTTTGGGGACTGCTGG - Intergenic
932725379 2:74175434-74175456 CCAAAAAGGTTAGGGACCACTGG + Intronic
932785993 2:74604330-74604352 CCAAAAAGTTTGGGGACCACTGG - Intronic
933224218 2:79726642-79726664 CCAGAAAGGTTAGGGACCGCTGG + Intronic
933410025 2:81913748-81913770 CCAGAAAGATTGGGGACCACTGG - Intergenic
934664011 2:96157748-96157770 CCACATGGGTTGGGGACCACAGG + Intergenic
934671447 2:96216008-96216030 CCAAAAAGTTTGGGGACCGCTGG - Intergenic
934740903 2:96721844-96721866 CCAAAAAGGTTGAGGACTACTGG - Intronic
935018965 2:99212221-99212243 CCAAAAAGGCGGGGGACCACTGG - Intronic
935228150 2:101072494-101072516 CCAGAAAGTTTGGGGACTGCTGG - Intronic
935584841 2:104791355-104791377 CCAAACAGGCTGGGAATCGCTGG - Intergenic
935615389 2:105074816-105074838 CCAAAAAGGCTGGGGACCACCGG - Intronic
935682557 2:105650822-105650844 CCAAAAAGGCTGGGGACCGCTGG - Intergenic
935716339 2:105942571-105942593 CTAAAAAGGTTGGGGACTACTGG - Intergenic
936228870 2:110682163-110682185 TCAAATAGGCTGGGGACTGCTGG - Intergenic
936689964 2:114874744-114874766 CCAAAAAGGTTGGGGACTGCTGG + Intronic
936775888 2:115972780-115972802 CCAAAAAGGTTGGGGACCAATGG - Intergenic
937296886 2:120814850-120814872 CCAAAAAGCTTCGGGACCATTGG + Intronic
937483423 2:122287723-122287745 CCAAAAAGGTTGGGAACTACTGG + Intergenic
937670275 2:124530920-124530942 CCAAAAAGGTTGGGGACCGCTGG - Intronic
938054917 2:128207819-128207841 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
938776071 2:134542701-134542723 CCAAAAGGGTTGGGGACCACTGG + Intronic
939054261 2:137344245-137344267 CCAAAAAAGTTGGGGACCACTGG + Intronic
939254758 2:139728419-139728441 ACAAAAAACTTGGGGACCACTGG + Intergenic
939899672 2:147837181-147837203 TCAAAAAGGTTGGGGACCGCTGG - Intergenic
940425401 2:153525702-153525724 CCAAAAAGGCTGGGGACCACTGG + Intergenic
940500986 2:154493427-154493449 CCAAAAAGGTAGGGGACTGCTGG + Intergenic
940511187 2:154617085-154617107 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
940965480 2:159832470-159832492 CCAAAAAGGTTGGGGACTGCTGG + Intronic
941002769 2:160218996-160219018 CCAAAAAGTTTGGGGACTGCTGG + Intronic
941150189 2:161905175-161905197 CCAAAATGGTTGCAGACCACCGG - Intronic
941350036 2:164420614-164420636 CCAAAAAGGTTGGGGACAATTGG - Intergenic
941403755 2:165063351-165063373 CCAAAAAGGCTGGTGACTGCTGG - Intergenic
941504896 2:166330578-166330600 CCAAGAAGGTTGGGGACTGCTGG - Intronic
941788789 2:169527749-169527771 GCAAAAAGGTTAGGGACTGCTGG + Intergenic
941949544 2:171139744-171139766 CCAAAAAGGTTGGGGACCACTGG - Intronic
942009878 2:171750934-171750956 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
942267377 2:174242149-174242171 CCAAAAAGGTTGGCGGCTGCTGG - Intronic
942810003 2:179987877-179987899 CCAAAAAGGTTTGAGACCGCTGG - Intronic
942840008 2:180348956-180348978 CCAAAAAGGTTGAAGACCATTGG - Intergenic
942906259 2:181184365-181184387 CAAACAAGTTTGGGGACCACTGG - Intergenic
942934460 2:181538091-181538113 CCAAAAAGGGTGGGGACCACAGG + Intronic
943248225 2:185483570-185483592 CCCAAAAGGTTGGGAACTGCTGG + Intergenic
943388567 2:187232670-187232692 CCAAAAGGGTTGGGGACTGCTGG + Intergenic
943396189 2:187338442-187338464 CCAAAAACGTTTGGGACCACTGG - Intergenic
943871008 2:192999318-192999340 CCCAAAAGGTTGGTGACCGCTGG - Intergenic
944775816 2:202963466-202963488 CCAAAAATATTGGGGACTGCTGG - Intronic
944901354 2:204219752-204219774 CCAAAAATGTTGGAGACTACTGG + Intergenic
945122946 2:206476674-206476696 CCAAAAAGGTTGGGGACCACTGG + Intronic
945570087 2:211456620-211456642 CCTAAAATGTTGGGAACCACTGG - Intronic
945671675 2:212809658-212809680 TCAAAAAGGTTGGGGACCACTGG + Intergenic
945736048 2:213601834-213601856 CCAAAAAGGTTGAGGACTGATGG - Intronic
946097525 2:217288392-217288414 CCAAAAAGGTTGGGGACCACTGG - Intronic
946296112 2:218784898-218784920 CCAAAAAGACTGGGGACCACTGG - Intronic
946649487 2:221875300-221875322 CCAAAAAGGTTGAGGACTGCTGG + Intergenic
946739785 2:222790198-222790220 CCTAAAAGCTGGGGGACCGCTGG - Intergenic
947218777 2:227772990-227773012 CCAAAAAGGTTGAGGACTGCTGG + Intergenic
947532166 2:230916398-230916420 CCCAAATAGTTGGGGACCACAGG - Intronic
948086864 2:235257925-235257947 GCAAAAAGGTTGGGGACTGCTGG - Intergenic
948128041 2:235579323-235579345 ACAAAAAGGCTGGAGACCTCAGG - Intronic
948372270 2:237496946-237496968 CCAAAAAGGTTGGGGACCACTGG - Intronic
948450472 2:238067388-238067410 CAAAAAAGTTTGGGGACTCCTGG + Intronic
948926319 2:241100997-241101019 CCAAAAACGTTGAAGACTGCTGG - Intronic
1169254600 20:4087209-4087231 CCAAAAAGTTTGGGGACCACTGG - Intergenic
1169407152 20:5331477-5331499 CCAAAAAGGTGGGAGACCACTGG - Intergenic
1169482848 20:6001068-6001090 CCAAAAAGGTTGGGGATTGCTGG - Intergenic
1169513836 20:6295404-6295426 GCTAAAAGGTTGGGGGCCGGAGG - Intergenic
1169698666 20:8421630-8421652 CAAAAAAGTTTGGGAACCACTGG - Intronic
1169756300 20:9046628-9046650 CCAAAAAAGTTGGGGACTGCCGG - Intergenic
1169757158 20:9055165-9055187 CTAAAAAGGTTGGGGACGGCTGG - Intergenic
1169924131 20:10765495-10765517 CCAAAAAGGCTGGGGACTGCTGG + Intergenic
1170127170 20:12976660-12976682 CCAAAAAGTTTGAGAACCGCTGG + Intergenic
1170187018 20:13602539-13602561 CCAAAAAGGTTGGGGACCACTGG - Intronic
1170195913 20:13689291-13689313 CCAGAAAGATTGGGGACCGCTGG + Intergenic
1172804964 20:37605163-37605185 CAAAAAAAATTGGGGACTGCTGG + Intergenic
1172993304 20:39051477-39051499 CCAAAAAGTTTGAGAACTGCTGG - Intergenic
1173150923 20:40565933-40565955 CCAAAAAGGGAGGGGACTGAGGG + Intergenic
1173320905 20:41986058-41986080 CTAAAAAGGTTGGGGACGGCTGG + Intergenic
1173477163 20:43368266-43368288 CCAAAAATGTTGGGGACCCCTGG + Intergenic
1173665751 20:44761965-44761987 CTAAAAAGGTTAGGGACCCCTGG - Intronic
1173810332 20:45951443-45951465 CCAAAAAGGGTGGGGACCACTGG - Intronic
1173926002 20:46781768-46781790 CCAAAAAGGCTGGGGACCGTTGG - Intergenic
1174194910 20:48766282-48766304 CCAAAACGGCTGGGGACCACTGG + Intronic
1174427923 20:50446366-50446388 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
1174564053 20:51452052-51452074 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1174866553 20:54141999-54142021 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1174906443 20:54557213-54557235 CCAAAAAGGTTGGGGACCACTGG - Intronic
1175023516 20:55876828-55876850 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
1175142880 20:56873761-56873783 CCACAAAGGTTGGGGACCGCTGG - Intergenic
1175142888 20:56873785-56873807 CCACAAAGGTTGGGGACCGCTGG - Intergenic
1175724767 20:61310324-61310346 CCAAAAACGTTGGGGACCACTGG - Intronic
1175729229 20:61342155-61342177 CCAAAAAGGTGGAGGACCGCTGG - Intronic
1176973805 21:15295653-15295675 CTTAAAAGGTTGGAGACCGCTGG - Intergenic
1177146295 21:17410643-17410665 CCAAAAATGTTGCTGACCACTGG + Intergenic
1177992265 21:28051924-28051946 CCAAAGAGGTTGGCCACCGGAGG + Intergenic
1178150458 21:29788502-29788524 CCAAAAGGGCTGGGGACCATTGG - Intronic
1178458389 21:32777327-32777349 TCAAAAAGGTTGGGGACTACTGG + Intergenic
1178555115 21:33583300-33583322 CCAAAAAGTTTGCGGACTGCTGG + Intronic
1178635208 21:34296404-34296426 CCAAAATGGTTGGGGACTGCTGG + Intergenic
1178672981 21:34608258-34608280 CCAAAAATGTTGGGGACCACTGG + Intronic
1179057131 21:37946476-37946498 CCAAAAAGGTAGGGGACCACTGG + Intergenic
1179186510 21:39089165-39089187 CCAAAAAGGTTGAGGACCGCTGG - Intergenic
1180018453 21:45103248-45103270 CCAAAAAGGTTGAGGACTGCTGG - Intronic
1181531854 22:23521650-23521672 CCGAAAACGTCTGGGACCGCTGG + Intergenic
1181567386 22:23747496-23747518 CCAAAAAGGTTGGGGATCACTGG + Intronic
1181683097 22:24509506-24509528 ACAAAAAGTTTGGGAACCACTGG - Intronic
1182220935 22:28758115-28758137 CCAAAAAGGCTGGGGACTGCTGG + Intergenic
1182381301 22:29890811-29890833 CCAAAAAGTTTGAAGACCACTGG - Intronic
1182721549 22:32405323-32405345 GCAAAAAGTTTGAGGACTGCTGG + Intronic
1182752894 22:32655907-32655929 CCAAAAAGGTTGGGAGTCGCTGG + Intronic
1182879312 22:33719954-33719976 CCAAAAAGGCTGGGGACTGCTGG - Intronic
1182974511 22:34610414-34610436 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1183337708 22:37260022-37260044 CCTAAAAGGTTGGGGACCGCTGG - Intergenic
1184023029 22:41833492-41833514 CCGGAAGGGTTGAGGACCGCCGG - Intronic
1184565804 22:45291148-45291170 CCAAAAAGGCTGGGGACTGCTGG + Intronic
1184623866 22:45706151-45706173 CCAAAAAGGTTGGGGACCACTGG + Intronic
1184794622 22:46724721-46724743 CCAAAAAGGCTGGGCTCAGCAGG + Intronic
949207143 3:1453926-1453948 CCAAAAAGGTTGGGGACCACTGG - Intergenic
949293710 3:2495809-2495831 CCAAAAAGGTTGGGGACCACTGG + Intronic
950219012 3:11180258-11180280 CCAAAAAGGTTGGGGACTGCTGG - Intronic
950347045 3:12306059-12306081 CCAAAAAGGTGGGGGACTGCTGG - Intronic
950436277 3:12982240-12982262 CCAAAAAGCTTGAGAACCACTGG - Intronic
950995245 3:17489060-17489082 CCAAAAACGCTGGGGACTACTGG + Intronic
951226561 3:20127695-20127717 CCAAAAAGGTTGGAGACCATTGG - Intronic
951434737 3:22648722-22648744 CCAAAAAGGTTGAGGGTCACTGG - Intergenic
952170860 3:30805719-30805741 AAAAAAAGGCTGGGGACTGCTGG - Intronic
952406105 3:33006482-33006504 CCAACAAGGTTGGGGACCACTGG + Intronic
952474025 3:33686585-33686607 CCAAAAAGGTTGGGGGCCGCTGG + Intronic
952643855 3:35631707-35631729 CCAAAAAAGTTGGGGACTATTGG + Intergenic
952840475 3:37641352-37641374 CCATAAAGGTTGGAGAACACTGG + Intronic
953137654 3:40197040-40197062 CCAAAAAGGCTGGGGACCCCTGG - Intronic
953300353 3:41768229-41768251 CCAAAAAGGGTGGAGACCACTGG + Intronic
953398222 3:42589807-42589829 CCAAAAAGGCTGGGGACCACTGG + Intronic
953785663 3:45909333-45909355 TCAAAAAGGTTGGGGACCGCTGG + Intronic
954635085 3:52066849-52066871 CCAAAAAGGTTGAGGACCGCTGG + Intergenic
954766095 3:52917862-52917884 CCAAAAACGTTGGGGACCGCTGG + Intronic
954820927 3:53326913-53326935 CCAAAAAGGTTGGGGAATGCTGG + Intronic
954966495 3:54616095-54616117 CCAAAAAGATTGGGGACCATAGG + Intronic
955022294 3:55132913-55132935 CCACAAAGGTTGGGGACCACTGG + Intergenic
955141514 3:56274357-56274379 CCAAACAGGTTGGGAACTGCTGG + Intronic
955304373 3:57815018-57815040 CCAAAAAGGTTGGAGACTGCTGG - Intronic
955719006 3:61862245-61862267 CCCAAAAGGTGGGGGACCGCTGG + Intronic
955728563 3:61959331-61959353 CCAAAAAGGTTGGGGACCGCTGG - Intronic
955733111 3:62008619-62008641 TCGAAAAGGTTGGGGACCGCTGG - Intronic
955952557 3:64257210-64257232 CCAAAAAGGTTGGGAACCACTGG - Intronic
956098983 3:65747852-65747874 CCAAAAAGTTTGAGAACCACTGG + Intronic
956115046 3:65909808-65909830 CCAAAAAGGTTAGTGATCGCTGG - Intronic
956153178 3:66264724-66264746 CCAAAAAGGTTGGGGACCGCTGG + Intronic
956331741 3:68117975-68117997 CCAGGAAGGTTGGGGACCACTGG - Intronic
956552084 3:70472536-70472558 CCCAAAAGATTGAGGACCTCTGG + Intergenic
956899698 3:73702406-73702428 CCAAAATGGTTGGGGGCCACTGG + Intergenic
956959826 3:74386215-74386237 TCAAAAGGGTTGGGGAATGCAGG + Intronic
957340686 3:78892352-78892374 CCAAAAAGGTTGGGGACCTCCGG + Intronic
957369941 3:79280627-79280649 CCAAAAAGGTTGGGGACCGCTGG - Intronic
957632293 3:82732808-82732830 CCAAAAGGGTTGGGGTCCACTGG - Intergenic
957654593 3:83058496-83058518 CCAAAAGGGTTGGGGACCAATGG + Intergenic
957724199 3:84043986-84044008 CCAAAAAGGTAGGGAACTGCTGG - Intergenic
958156497 3:89762001-89762023 CCAAAATGGTTGGGCAGCTCAGG + Intergenic
958189175 3:90162584-90162606 CCAAAAAGTTTGGGGACTGCTGG - Intergenic
958411487 3:93822216-93822238 CCCAAAAGTTTGGGGACTGCTGG - Intergenic
958981045 3:100720439-100720461 GCAAAAAGGTTGGCGACTACTGG - Intronic
959045065 3:101464803-101464825 CCAAAAAGGTTGGGGACCGCTGG + Intronic
959048299 3:101498978-101499000 CCAAACAGGTTGGGGACCACTGG + Intronic
959260569 3:104074561-104074583 CCAAAAAGGTTGGGGACCACTGG - Intergenic
959371593 3:105533769-105533791 CCAAAAAGGTTGGAGACCACTGG - Intronic
959620722 3:108396281-108396303 CCAAATGGGTTGGGGACCGCTGG - Intronic
960225155 3:115159334-115159356 CCAAAAATGTTGGGGACTACTGG + Intergenic
960443189 3:117714610-117714632 CTAAAAAGGTTGGGGACTGTTGG + Intergenic
960584669 3:119309832-119309854 CCAAAAAAGTTGGGGACCACTGG + Intronic
960584789 3:119310719-119310741 CCAAGAAGGTTGGGGACTGCTGG + Intronic
960652130 3:119962724-119962746 CCAAAAAGGTTGAGGACTGCTGG - Intronic
960879664 3:122331838-122331860 CCAAAAAGGTTGGGGACAGCTGG - Intronic
961391619 3:126555710-126555732 CCAAAAAGGTTAGGGACCACTGG + Intronic
961727248 3:128939668-128939690 CCAAATAGGTTGGGGACCGCTGG - Intronic
961842060 3:129722458-129722480 CCAAAAAGGTTGGGGACTGCTGG + Intronic
962087330 3:132205381-132205403 CCAAAAAAGTTGGGAACTGCTGG - Intronic
962244960 3:133784761-133784783 CCAAAGAGGTTGGGGACCACTGG + Intronic
962754350 3:138456804-138456826 GCAAAAAGATTGGGGACCGTTGG + Intronic
963200752 3:142583657-142583679 CCAAAAAGGTTGAGGACAGCTGG - Intergenic
963537450 3:146545441-146545463 CCAAAAAGGTTGGGGACCACTGG - Intergenic
963578906 3:147099610-147099632 CCAAAAAGGTTGGGGAGTGCTGG - Intergenic
963744827 3:149115554-149115576 CCAAAAAGGTTGGAGACCGCTGG + Intergenic
963820970 3:149892808-149892830 CCAAAAAGGTTGGGGACCCCTGG + Intronic
963890583 3:150631874-150631896 CAGAAAAGGTTGGGGACCGCTGG + Intergenic
964165796 3:153703933-153703955 CCAAAAAGGCTGGGGACCACTGG - Intergenic
964378323 3:156071359-156071381 CTAAAAAGGTTGGGGACTGCTGG + Intronic
964783978 3:160373449-160373471 CCAAAAAGGCTGGGAATCACTGG - Intronic
964790223 3:160446964-160446986 CCAAAAAGGTTGAGGACTGCTGG + Intronic
964815998 3:160718700-160718722 CCAAAAAGTTTGGGAACTGCTGG - Intergenic
965498461 3:169428239-169428261 TACAAAAGGTTGGGGACCACTGG - Intronic
965569844 3:170161356-170161378 CCAGAAAGTTTGGGGACCACTGG - Intronic
966090101 3:176123245-176123267 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
966158712 3:176945908-176945930 CCCAAAAGTTTGGGGACTGCTGG + Intergenic
966177209 3:177151595-177151617 CCAAAAAGGTTGGGGACCACTGG + Intronic
966363444 3:179154522-179154544 CCAAAAAAGTTGGGGACCACTGG + Intronic
966556845 3:181271784-181271806 CCAAAAGGGTTGGGGACCGCTGG + Intergenic
966802173 3:183774481-183774503 CCACAAAGCTTGGGGACAGCTGG + Intronic
967056038 3:185829228-185829250 CCAAAATGGTTGGGGACTACTGG - Intergenic
967361303 3:188634941-188634963 CCAAAAAGGTTGGGGACCACTGG + Intronic
967518505 3:190400085-190400107 CCAAAAAGGTTGAAGACCACTGG + Intronic
967602141 3:191402372-191402394 CCAAAAAAGTTGAGGACCACTGG + Intergenic
967786253 3:193500422-193500444 CAAAAAAGGTTGGAGATCGCTGG - Intronic
968055434 3:195687885-195687907 CCAAAAAGGTTAGGGACTGCCGG + Intergenic
968100361 3:195960713-195960735 CCAAAAAGGTTAGGGACTGCCGG - Intergenic
969697382 4:8742291-8742313 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
970510071 4:16773206-16773228 CCAAAAAGGTTGGGGACTGACGG - Intronic
970536685 4:17037269-17037291 CCAAAAAGGTTGAGAACTGCAGG + Intergenic
970588761 4:17540424-17540446 CCAAAAAGGCAGGGGACCGCTGG - Intergenic
970929864 4:21496942-21496964 CCAAAAAAGTTGGGGACTGCTGG + Intronic
971212964 4:24637465-24637487 CTACTAAGGTTGGGGACCACTGG + Intergenic
972419855 4:38877117-38877139 CCAAAAAGGTTGGGGACTGCTGG - Intronic
972427237 4:38944879-38944901 CCAGAAAGGTTGGGGACCACTGG + Exonic
972495023 4:39626267-39626289 CAAAAAAGGTTGGGGACCACTGG + Intronic
972667771 4:41183759-41183781 CCAAAAAGGTTGGGGACAACTGG - Intronic
972710715 4:41591828-41591850 CCAAGAAGGTTGGGCACAGAAGG + Intronic
973095981 4:46200227-46200249 CCAAAAATGTTGGAGACCACTGG + Intergenic
973205493 4:47555387-47555409 CCAAAAAGGTTGAGGACCGCTGG + Intronic
973670471 4:53211909-53211931 CCAAAAAGTTTGAGAACCACTGG + Intronic
973729416 4:53809246-53809268 CCAAAAAGGTTGGGGACTCCTGG + Intronic
974540009 4:63221398-63221420 CTAAAAATGTTGGGGACTGCTGG + Intergenic
974671133 4:65031803-65031825 CAAAAAAGTTTGGGGATTGCTGG - Intergenic
976555644 4:86448641-86448663 CCAAAAATGTTGGGGAGTGCTGG - Intronic
976668114 4:87622202-87622224 GCCAAAAAGTTGGGGACCACTGG - Intergenic
976672210 4:87666102-87666124 GCAGAAAGTTTGGGGACCACTGG - Intergenic
976822303 4:89220101-89220123 TCAAAAAGTTTGGGGACTGCTGG + Intergenic
976845437 4:89483673-89483695 CCAAAAAGGTTGGGGACCACTGG + Intergenic
977027052 4:91833082-91833104 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
977099965 4:92798967-92798989 TCAAAAAGGCTGGGGACCATTGG - Intronic
977263925 4:94832178-94832200 CCAAAAAGGTTGAGAACCGCTGG + Intronic
977375459 4:96197442-96197464 CCAAAAAGGTTGGGGAGCGCTGG - Intergenic
977612537 4:99050879-99050901 CAAAATAGGTTGGGGACTGCTGG + Intronic
977775453 4:100914129-100914151 CCAAAAAGGTTTGGGACCACTGG + Intergenic
977810513 4:101350154-101350176 CCAAAAAGGTTGGGGATCTCTGG - Intergenic
977955258 4:103019074-103019096 CCAAAAAGGTTGGGGACTGCTGG + Intronic
977957932 4:103052091-103052113 CCAAAAAGGCTGTGGACTGCTGG - Intronic
978055860 4:104265111-104265133 CCAAACAGGTTGGGAACCCCTGG + Intergenic
978209383 4:106117036-106117058 CCAAAACGGCTGGGGACCGCTGG + Intronic
978222498 4:106293583-106293605 CCAAAAAGTTTGGGGACTGCTGG + Intronic
978347262 4:107784695-107784717 CCGAAAAGGTTGGGGAACACTGG + Intergenic
978471619 4:109073970-109073992 CCAAAAAGGTTGGGGACCACTGG - Intronic
978499714 4:109396082-109396104 CCAAAAAGTCTGGGGTCTGCTGG + Intergenic
978810325 4:112842438-112842460 CCAAAAAGGTTGGGGACCACTGG - Intronic
978952070 4:114572756-114572778 CCAAAAAGGTTGGGGACAGCTGG + Intergenic
978989084 4:115055394-115055416 CCAAAAAGATTGGGGATCACTGG + Intronic
979007294 4:115315834-115315856 CCAAAAAGGTTGGGGACTGTTGG + Intergenic
979095627 4:116546571-116546593 ACAAAAAGGTTGGGAACCTTTGG - Intergenic
979350295 4:119636655-119636677 CCAAAAAGGTTGGAGGCTGCTGG - Intergenic
979489548 4:121309325-121309347 CCAAAAATGTTGGGAACCACTGG + Intergenic
979685105 4:123503509-123503531 CCAAAAAGATTAGGGACTGCTGG - Intergenic
979791022 4:124781178-124781200 CCAAAAAGGTTGGGGACCACTGG + Intergenic
979837255 4:125386851-125386873 CCAAAAAGTTTGGGGACCACTGG - Intronic
980021164 4:127711793-127711815 CCAGAAAGGTTGGGGACTGCTGG + Intronic
980508315 4:133752615-133752637 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
980627281 4:135390206-135390228 CCAAAAAGGTTGGGGACAACTGG - Intergenic
981721831 4:147809654-147809676 CCGAAAAGGTTGGGGACCGCTGG - Intronic
981786323 4:148483160-148483182 CCAAAAATGTTGGGGACCACTGG + Intergenic
981979994 4:150780744-150780766 CCAAAAAGGTTGGGGACTGCTGG - Intronic
982106047 4:152012895-152012917 GCAAAAAGGTTGGGGACTTCTGG + Intergenic
982713682 4:158784358-158784380 CCAAAAAGGTTGGGGACCACTGG - Intronic
983110336 4:163742131-163742153 CCAAAAATCATGGGGACCACTGG + Intronic
983251800 4:165354191-165354213 CCAAAAAGATTGGGGACCACTGG - Intergenic
983295020 4:165856511-165856533 CCTAAAAGGTTGGGGACCACTGG - Intergenic
983631801 4:169857011-169857033 CCAAAAAGGTTGGGGACCACTGG - Intergenic
983763248 4:171440500-171440522 CCAAAAAGGGTGGGGACCGCTGG + Intergenic
983850183 4:172570604-172570626 CCATAAAGGTTGGGGTCCACTGG - Intronic
983976056 4:173935881-173935903 TGAAATAGGTTGGGGACCGAGGG - Intergenic
984079844 4:175233560-175233582 CCAAAAAGGTTGGGAACCCCTGG + Intergenic
984736069 4:183109403-183109425 CCTGAAAGGTTGGGGACTGCTGG - Intronic
984799710 4:183703196-183703218 CCAAAAAGTTTGAGAACTGCTGG - Intronic
984823332 4:183903777-183903799 TGAAAAAGGTTGGGGGCCGCTGG - Intronic
985110343 4:186541385-186541407 CCCATCAGGTTGGGGACCCCTGG - Intronic
985205484 4:187530835-187530857 GCCAAAAGGTTGGGGACCAATGG + Intergenic
985488310 5:164161-164183 GCAAAAAGGATGGGGATTGCTGG - Intronic
985636915 5:1040273-1040295 GCAAAAAGGTTGGGGACTGCTGG + Intergenic
986122375 5:4853495-4853517 CCAAGAAGCTTGGGGACCACTGG - Intergenic
986216400 5:5723587-5723609 CCAAAAATGTTGGGAACTGCTGG - Intergenic
986294831 5:6429317-6429339 CCAAAAAGTTTGGGGACTACTGG + Intergenic
986700767 5:10406213-10406235 CCAAAATGGTTGGGGACCACTGG + Intronic
986778164 5:11038515-11038537 CCACAAAGGTTGGGGAACGTTGG + Intronic
986808857 5:11334626-11334648 CCGAAAATGTTGGGAACCACTGG + Intronic
987017912 5:13838792-13838814 CCAGAAAGGCTGGGGACCACTGG + Intronic
987091660 5:14513218-14513240 CCAAAAAGGTTGGGGACCACGGG - Intronic
987222527 5:15804897-15804919 CCAAAAAGATTGGGGACCATTGG + Intronic
987439775 5:17941801-17941823 CCAAGATGTTTGGGGACCACTGG - Intergenic
987443512 5:17986844-17986866 CCAAAAAGGTTAGGAACCTCTGG - Intergenic
988589552 5:32536866-32536888 CCAAAAATGTTGGGGACCACTGG + Intronic
988808172 5:34759813-34759835 CCAAAAAGGTTGGGGACTGGTGG + Intronic
989091769 5:37741412-37741434 CCAAAAAGGTTGGAGACAGCTGG - Intronic
989704813 5:44316277-44316299 CCAAAAAGGTTGGGGACCGCTGG + Intronic
989771416 5:45151078-45151100 TCAAAAAGCTTGGGGACTGCTGG - Intergenic
990397175 5:55394391-55394413 CCAAAAAGACTGGGGACTGCTGG - Intronic
990491044 5:56303409-56303431 CCAAAAAGGTTGGGGACCACTGG - Intergenic
991095015 5:62730915-62730937 TGAAAAAGGCTGGGGACCACTGG - Intergenic
991098026 5:62759827-62759849 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
991187290 5:63825103-63825125 CCAAAAAGGTTGGGAACTGCTGG - Intergenic
991230609 5:64329313-64329335 CTAAAAAGGTTGAGGACTGGTGG - Intronic
992037435 5:72793889-72793911 CCAAAAAGGTTGGGGGCCACTGG + Intergenic
992299586 5:75364536-75364558 AAAAAAAGGTTTGGGACCACTGG - Intergenic
992518345 5:77521102-77521124 CCAAAAAGGTTGGGGACTGCTGG - Intronic
992566303 5:77998517-77998539 CCAGAAAGGTTAGGGACCACTGG - Intergenic
992685401 5:79194539-79194561 CCAAAAAGTTTGGGGACCGCTGG + Intronic
993078749 5:83269796-83269818 CCAAAAAGGTTGGGGACCTCTGG - Intronic
993833334 5:92786907-92786929 CCAAAAAGGTTGAGGACCGCTGG - Intergenic
993923015 5:93830711-93830733 TCAAAAAGGTTGGGGACTGCTGG - Intronic
994151203 5:96449516-96449538 CCAAAAATATTGGGAACCGCTGG + Intergenic
994329448 5:98488562-98488584 CCAAAAAGGTTGGTGACCACTGG - Intergenic
994424625 5:99569127-99569149 TCAAAATGGTTGGGGACCAATGG + Intergenic
994632607 5:102304927-102304949 CCAAAAAGATTGGGGACTTGGGG - Intergenic
994943819 5:106359525-106359547 CCAAAAAGGTTGGGGACCACTGG + Intergenic
995305276 5:110639744-110639766 CCAAAAAGGTTGGGGACTGCTGG - Intronic
995339663 5:111043936-111043958 CCAAAACGACTGGGGACCACTGG - Intergenic
995354444 5:111222766-111222788 CCGAAAAGGTTGGGGACCGCTGG + Intergenic
995627865 5:114098661-114098683 CCAAAAAGGTTGGGGACCGCTGG + Intergenic
995778772 5:115754033-115754055 CCAAAAAGATTGGAGACCACTGG + Intergenic
996045032 5:118862273-118862295 CCAAAAAGGTTGGGGACTACTGG + Intronic
996049891 5:118920119-118920141 CCAAAAAGACTGGGGACTGCTGG + Intronic
996583231 5:125054746-125054768 CCAAAAATGTTGGGAACTGCTGG + Intergenic
996613760 5:125415093-125415115 CTAAAAAAGTTGGAGACCACTGG - Intergenic
996859861 5:128053215-128053237 CCAAAAAGGTTGGGGACTTCTGG - Intergenic
997141486 5:131386069-131386091 CCAAAAAGGTTGGAGACCACTGG - Intronic
997281110 5:132646533-132646555 CCAAAATGGTTGGGGACTGCTGG - Intergenic
997898367 5:137740620-137740642 CCAAAAAGGTTGGGGCCTGCTGG - Intergenic
997900345 5:137757695-137757717 CCAGAAAAGTTGGGCACTGCTGG - Intergenic
998072761 5:139211149-139211171 CCAAAAAGGCTGGGGACCACTGG + Intronic
998481647 5:142467986-142468008 CCAAAAAGGTTGGGGACCACTGG + Intergenic
998606279 5:143638453-143638475 CCAAAAACTTTGGGGACCACCGG - Intergenic
998840271 5:146245906-146245928 TCAAAAAGCTTGGGGACTGCTGG + Intronic
999145543 5:149390914-149390936 TCAAAAAGGGTTGGGACCCCTGG + Intronic
999193722 5:149767761-149767783 CCAAAAAAGTTGGAGACCGCTGG - Intronic
999512625 5:152268658-152268680 CCAAAAAGGTTGGGGATGGCTGG - Intergenic
999516853 5:152310459-152310481 CCAAAAACGTTGGGGGCTGCTGG - Intergenic
999520765 5:152348720-152348742 CCAAAAAGGTTGGGGGCCACTGG - Intergenic
999871774 5:155758795-155758817 GCTAAAAGGTAGGGGACCTCTGG + Intergenic
999883621 5:155894972-155894994 CCAAAAAGGTTGAGGACCACTGG + Intronic
1000362519 5:160461185-160461207 CCAAAAAGGTTAAGGACCACTGG - Intergenic
1000656358 5:163884087-163884109 CCAAAAAGGTTGTAGACCACTGG - Intergenic
1000913459 5:167050450-167050472 GCCAAAAGGTTGGAGACCGCTGG + Intergenic
1000957349 5:167558851-167558873 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1001010697 5:168095227-168095249 GCAAAAAGGTTGGGGACCGCTGG + Intronic
1001164329 5:169349708-169349730 CCAAAAAGGTTGAAGACCACTGG + Intergenic
1001312700 5:170622860-170622882 CCAAAAGGGTTGGGGACCACTGG - Intronic
1001359315 5:171065233-171065255 CCAAAAAGGTTGAGGATGGTTGG - Intronic
1001841311 5:174879072-174879094 CCATGAATGTTGGGGACAGCAGG + Intergenic
1001867735 5:175120167-175120189 CTAAAAAGGTTGGAGACTGCTGG - Intergenic
1001910772 5:175515684-175515706 CTAAAAAGGTTTGGGACCGCTGG - Intronic
1002650712 5:180691088-180691110 TCAAAAAGGCTGGGGACCACTGG + Intergenic
1003143480 6:3490807-3490829 CCAAAAAGATTGGGGAACTGTGG + Intergenic
1003342757 6:5237600-5237622 CCAAAAAGGTTGGGGACCACTGG + Intronic
1003439088 6:6122789-6122811 CCCAAAAGCTTGGAGACCTCAGG - Intergenic
1003592332 6:7446574-7446596 CCAAAAAGGCTAGGGACGGCTGG - Intergenic
1003779745 6:9411371-9411393 CCAAAAAGTTTTGGGACCACTGG - Intergenic
1004121267 6:12824459-12824481 CCAAAAAGGCTGGGGACTGCTGG + Intronic
1004165040 6:13249417-13249439 CCAAAAAGGTTGGGGACAGCTGG + Intronic
1004373743 6:15074549-15074571 CCAAAAAGGTTGGGGACCGCCGG - Intergenic
1004549747 6:16635448-16635470 CCAAAAAGGTTAGGGACCACTGG + Intronic
1004632726 6:17437242-17437264 CCAAAAAGGTTGGGGACCACTGG + Intronic
1004672464 6:17810465-17810487 CCAAAAAGGTTGGGGACCACTGG - Intronic
1004770120 6:18771825-18771847 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1004779822 6:18895996-18896018 CCAATAAGGTTGGGTACCGCTGG + Intergenic
1004982353 6:21039349-21039371 CTAAAAAGTTTGGGGACTGCTGG + Intronic
1005103988 6:22203446-22203468 CCGAAAAGGTTAGGGACCAGCGG + Intergenic
1005465263 6:26106899-26106921 TCAAAAAGGTTGGAGACTACTGG - Intergenic
1005660564 6:27994530-27994552 CCAAAAAGGTTTGGGATCACTGG + Intergenic
1006507175 6:34496762-34496784 CCACAAAACTTGGGGACCACAGG - Intronic
1006644882 6:35509194-35509216 GCAAAAAGGTTGGGGCCCAGAGG - Exonic
1007053336 6:38856014-38856036 CCAAAAAGGCTGGGGACCACTGG + Intronic
1007343931 6:41213768-41213790 CCATAAAGGTTGGGGATCACTGG + Intergenic
1007420960 6:41719426-41719448 CCAAAAAGGTTGGGGACCGCTGG + Intronic
1007921704 6:45616064-45616086 CCAAAAAGGTTGGGGACCACTGG + Intronic
1008332069 6:50257286-50257308 CCAAAAAGGTTAGGGACTGCTGG + Intergenic
1009045622 6:58234185-58234207 CCAAAAAAGTTGAGGAGCACGGG - Intergenic
1009197255 6:60702206-60702228 CCAAAAAGGTTGGGGAGTGCTGG - Intergenic
1009221440 6:60988505-60988527 CCAAAAAAGTTGAGGAGCACGGG - Intergenic
1009517822 6:64641975-64641997 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1009899341 6:69792897-69792919 CCAAAAAGTTTGGGAATCTCTGG - Intronic
1009958279 6:70484492-70484514 CCAAAAAAGTTGGGGACTGCTGG - Intronic
1010040958 6:71383401-71383423 CCAAAAAGGCTGGGGACCGGTGG - Intergenic
1010717512 6:79246389-79246411 CCTAAACAGTTGGGGACCACTGG + Intergenic
1012060254 6:94469275-94469297 CCATAAAGTTTGGGGAACACTGG + Intergenic
1012433944 6:99194629-99194651 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1013104317 6:107013800-107013822 CCAAAAAAGTTGGGGACTGGTGG - Intergenic
1013227059 6:108127454-108127476 CCAAAAAGGTTGGGGACCACTGG - Intronic
1013465803 6:110415988-110416010 CCTAAAAGGCTGGGGACTGCTGG - Intergenic
1013569565 6:111408261-111408283 CCAAAAAGTTTGAGAACCACTGG - Intronic
1013594666 6:111649829-111649851 CCAAAAAGGTTGGGGACAGCTGG - Intergenic
1013790845 6:113834878-113834900 CCAAAACTGTTGGTGACCCCTGG + Intergenic
1013958997 6:115875280-115875302 CTAGAAAGGATGGGGACGGCTGG - Intergenic
1014102781 6:117530235-117530257 CCAAAAAGGTTCGGGACTGCTGG - Intronic
1014151482 6:118061675-118061697 CCACAAAGGTTGGGGACTGCTGG - Intronic
1015074124 6:129134483-129134505 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1015084529 6:129272956-129272978 CCAAAAATTTTGGGGACCACTGG + Intronic
1015094042 6:129393285-129393307 CTCAGAAGGTTGGGGACTGCGGG + Intronic
1015280191 6:131425529-131425551 CCAAAAAGATTGGGGGCCACTGG - Intergenic
1015465600 6:133544829-133544851 CCAAAATGGTTGGGGACTGCTGG + Intergenic
1015553898 6:134440969-134440991 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1015593444 6:134843951-134843973 CCAAAAAGTTTGGGGACTGTTGG - Intergenic
1015652789 6:135481031-135481053 CCAAAAAGGTTGGGGACGGCTGG + Intronic
1015985607 6:138881419-138881441 CCAAAAAGGTTGGGGATCACTGG - Intronic
1016518066 6:144918848-144918870 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1016580126 6:145620113-145620135 CCAAAAAGGTTGGGGACCACTGG - Intronic
1016608335 6:145960799-145960821 CCAAAAAGGTTGGGAACTGCTGG - Intronic
1016702255 6:147067188-147067210 CCAAAAAGGTTGGGGACTACTGG - Intergenic
1016845037 6:148561299-148561321 CCAAAACGGTTGGGGACTGCTGG + Intergenic
1017249082 6:152260662-152260684 CCAAAAAGGTTGGGGATCGCTGG - Intronic
1017318215 6:153057533-153057555 CCAGAAAAGTTGGGGACCGCTGG - Intronic
1017375351 6:153761817-153761839 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1017430871 6:154369576-154369598 CCAAAAAGGTTGGGAACCAATGG + Intronic
1017886393 6:158603210-158603232 CCAAAAAGGCTGGGGACCACTGG - Intronic
1017969468 6:159299231-159299253 CCAGAAAGGTTGGGCACCGCTGG + Intergenic
1018596582 6:165487567-165487589 GCCAAAAGGTTGGGAACCGCTGG + Intronic
1018891370 6:167985639-167985661 GGAAAAAGGTTGGGGACCTCTGG + Intergenic
1019385047 7:750399-750421 CCAAAATGGCAGGGGACCGCTGG - Intronic
1019699260 7:2465753-2465775 CTAAAAAGGCTGGGGACCGCTGG + Intergenic
1019802592 7:3099307-3099329 CCAAAAAGGTTGGGGACCATTGG + Intergenic
1020184272 7:5946993-5947015 CCAAAAAGGTTGGGGACCTCTGG - Intronic
1020298645 7:6777773-6777795 CCAAAAAGGTTGGGGACCTCTGG + Intronic
1021062841 7:16134461-16134483 ACAAAAAGGTTGGGGATTGCTGG + Intronic
1021461196 7:20888787-20888809 CCAGAAAGGTTGGGGACCACTGG + Intergenic
1021738546 7:23662550-23662572 GCCAAAAAGTTGGGGACCACTGG + Intergenic
1021885258 7:25131447-25131469 CCAGAAAGGTTGTGGACTGCTGG + Intergenic
1022573914 7:31479592-31479614 CCAAATATGTTGGGGCCGGCAGG + Intergenic
1022579414 7:31534208-31534230 CCAAAAAGGTTGAGGACTGCTGG + Intronic
1023031503 7:36093814-36093836 CCAAAAACGTCGGGGACTGCTGG + Intergenic
1023529185 7:41135879-41135901 CCCAAAAGGTTGGAGACACCAGG + Intergenic
1023640386 7:42251173-42251195 CAGAAAAGGTTGGGGGCGGCTGG - Intergenic
1023708479 7:42967030-42967052 CCCAAAAGGTTGGTGTCCTCTGG + Intergenic
1023728783 7:43170408-43170430 CCAAAAAGGTTGGAGACCGCTGG + Intronic
1024281696 7:47724173-47724195 CCAAAATGGTTGGGAACCGCTGG + Intronic
1024331993 7:48164249-48164271 CCAAAAAGGTTGGGTACCTCTGG - Intergenic
1024493666 7:50016970-50016992 CCAAAAAGGCTGGGAACTGCTGG - Intronic
1025014118 7:55425037-55425059 CCAAAAAGGTTGGAGACCGCTGG + Intronic
1025137179 7:56428205-56428227 CCAAAAAGACCGGGGACAGCTGG - Intergenic
1025937636 7:66049854-66049876 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1026564062 7:71475152-71475174 CCAACATGGTTGGGGACCACTGG - Intronic
1026647815 7:72187658-72187680 CCAAAAGGGTTGGAGACTGCTGG + Intronic
1026663385 7:72321934-72321956 CCAAAAATGTTGGGGACAGCTGG - Intronic
1027132182 7:75598965-75598987 CCAAAAAGGCTGTGGAGCCCAGG - Intronic
1027151760 7:75738624-75738646 CCAGGAAGGTCGGGGACCCCAGG - Intronic
1027817822 7:83000450-83000472 CCAAAAAGTTAGGGGACATCTGG - Intronic
1028391842 7:90325936-90325958 CCAAAAAGGTTAGGGACTATTGG + Intergenic
1028545762 7:91997976-91997998 CCAAAAAGGTTGGGGACCACTGG - Intronic
1028641884 7:93051597-93051619 CCAAAAAGGTTGGAGACTGCTGG - Intergenic
1028653726 7:93178665-93178687 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1028749983 7:94372222-94372244 CCAAAAGGGTTGAGGACTGCTGG + Intergenic
1028798926 7:94938336-94938358 CCAAAAAGGTTGGGGAGTGCTGG + Intronic
1028833118 7:95346869-95346891 ACATAAAGGTTGGGGACCATTGG - Intergenic
1029156905 7:98523772-98523794 CCAAAAAGGTTGGGGATCACTGG - Intergenic
1029206432 7:98871744-98871766 CCAAAAAGGTTGGGGACTACTGG + Intergenic
1029347733 7:99990956-99990978 CCAAAGAGATTGGGGACCGCCGG + Intergenic
1029431685 7:100535231-100535253 CCAAAACGGTTGGGGACTGCTGG - Intergenic
1029501860 7:100936012-100936034 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
1029929606 7:104356929-104356951 CCAAAAAGGTTGGAGACCTCTGG + Intronic
1030282589 7:107792181-107792203 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1030444049 7:109626306-109626328 CCAAAAAGGTTAGGGACCACTGG + Intergenic
1030810854 7:113970714-113970736 CCAAAAAAGTTGCGGACCTCTGG - Intronic
1031169700 7:118277083-118277105 CCAAAAAGGTTGGGTACTGCTGG + Intergenic
1031347339 7:120685120-120685142 CCAAAAAGTTTCGGGACTGCTGG + Intronic
1031497268 7:122465703-122465725 CCAAAAAGGTTGAGGACCACTGG + Intronic
1032093773 7:128927300-128927322 CCAAAAAGGTTGGGCACCACTGG - Intergenic
1032116141 7:129118782-129118804 CCAAAAATGTTGGGGACCACTGG + Intergenic
1033292555 7:140099811-140099833 CCAGAAAGGTTGAGGACCACTGG + Intronic
1033397195 7:140986350-140986372 CCAAAAGGGTTGAGGACCGCTGG + Intergenic
1033479871 7:141728987-141729009 CCAAAAAGGTTGGGGACCGCTGG + Intronic
1033481051 7:141741081-141741103 CCAAAAAGGTTGGGGTCTGCTGG - Intronic
1033832743 7:145272978-145273000 CCAAAAAGGTTGGAAACCACTGG - Intergenic
1034144079 7:148852996-148853018 GCAAAAAAGTTGGAGACTGCTGG - Intronic
1034635163 7:152561362-152561384 CCAAAAAGTTTGGGGACTGCTGG + Intergenic
1034685284 7:152965832-152965854 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1034729903 7:153378070-153378092 CCAAGAAGGTTGGAGACTGCTGG - Intergenic
1034735722 7:153427792-153427814 CCAAAAATGTTGGGGACCACTGG - Intergenic
1034905450 7:154940697-154940719 CCAAAAAGGTAAGGGGCTGCTGG + Intronic
1035445571 7:158940135-158940157 CCAAAAAGGTTGGGGACCACTGG - Intronic
1035791648 8:2311740-2311762 CCAAAAAGGTTGGGGACTTCTGG - Intergenic
1035801157 8:2409965-2409987 CCAAAAAGGTTGGGGACTTCTGG + Intergenic
1036132694 8:6131226-6131248 CCGAGAAGGTTGGGGACTGTCGG - Intergenic
1036171953 8:6495932-6495954 CCAAAAAGGTTGGAGACTGCTGG - Intronic
1036445386 8:8817637-8817659 CCAAACAGGTTGGGGACTGCTGG - Intronic
1036578610 8:10052430-10052452 CCAAAAAGGTGGGGGACCGCTGG + Intergenic
1036692600 8:10953239-10953261 CCAAAAAGGTTGGGGATTGCTGG + Intronic
1037333179 8:17764819-17764841 CCAAAAAGGTTGGGGACCACGGG - Intronic
1037514457 8:19616837-19616859 CCAAAAAGGTTGGGGACCGCTGG - Intronic
1037603569 8:20419261-20419283 CCAAAAAGGTTGGGAACCGCTGG - Intergenic
1037651427 8:20842441-20842463 CCAAGAGGGTTGGGGAATGCAGG + Intergenic
1038092500 8:24269807-24269829 CCAAAAAGGTTGGGGACCATTGG + Intergenic
1038166822 8:25093524-25093546 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1038285294 8:26200961-26200983 GCCAACAGGTTGGGGACTGCTGG + Intergenic
1038372700 8:27009858-27009880 CCAAAAATGTTGGGGACTGCTGG + Intergenic
1038607672 8:29025019-29025041 CCAAAAAGGTTGGAGAACACTGG + Intronic
1038675939 8:29623075-29623097 CCAAAAAGGTTGGGGACCATTGG - Intergenic
1038681329 8:29671049-29671071 CCAAAAAGGTTGGGCACTGCTGG + Intergenic
1038745844 8:30254025-30254047 CCAAATATGCTGGGGACTGCTGG - Intergenic
1038841507 8:31188751-31188773 CCAAAAAGGTTGGGGACCTCTGG - Intergenic
1038863586 8:31414448-31414470 CCAAAAAGACTGGAGACCTCTGG - Intergenic
1040010632 8:42658428-42658450 CCAAAAAGGTTGGGGACCGCTGG - Intergenic
1040087523 8:43360874-43360896 CCAACATGGTTGGGGACAGCTGG + Intergenic
1040404978 8:47092134-47092156 CCAACATGGTTGGGGACAGCTGG - Intergenic
1040546275 8:48400445-48400467 CCCAAAAGGTCGGGGACTGTCGG + Intergenic
1041166621 8:55098649-55098671 CCAAAAGGGTTGGAGACAGCTGG - Intergenic
1041213040 8:55571949-55571971 CCAAAAAGGTTGGGGATCACTGG + Intergenic
1041439764 8:57882091-57882113 CCGAAAAGGGTAGGGACTGCTGG + Intergenic
1041450695 8:58003967-58003989 CCAAAAATGTTGGGGACTGCTGG - Intronic
1042068691 8:64906747-64906769 GCAAAAAGGTTGGGGACTGCTGG - Intergenic
1042707939 8:71681267-71681289 CCAAAAAGGTTGAGGACCACTGG + Intergenic
1043126267 8:76399389-76399411 CCAAAAGGGTTGGGCACAACTGG + Intergenic
1043772856 8:84226336-84226358 CCAAAAAGGTTGGAGATCGCTGG + Intronic
1043781355 8:84339689-84339711 CAAAAAAGCTTAGGGACTGCTGG + Intronic
1043794620 8:84520882-84520904 CCAAACAGTTTGGGGACCACTGG + Intronic
1043845924 8:85164137-85164159 AAAAAAAGGTTGGTGACTGCTGG - Intergenic
1043979104 8:86617783-86617805 CCAAAAAGACTGGGGACTGCTGG - Intronic
1044027684 8:87194189-87194211 CCAAAATGGTTGGGGAACAATGG + Intronic
1044246787 8:89957799-89957821 CCAAAAAGGATGGGAACTGCTGG - Intronic
1044519055 8:93176601-93176623 CCAAAAAGGTTGAGAATTGCTGG + Intergenic
1044586741 8:93875496-93875518 CCAAAAAGGTTGGAGACCGCTGG - Intronic
1044866349 8:96574824-96574846 CCAAGCAGGTTGGGGACCACTGG - Intronic
1045006685 8:97922157-97922179 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1045294366 8:100860775-100860797 CCAAAAGGGCTGGGGACCACTGG - Intergenic
1045333963 8:101181695-101181717 CCAAAAACACTGGGGACCACTGG - Intronic
1045413236 8:101941152-101941174 TCATAAAGGTTGGGGACCACTGG - Intronic
1045531521 8:102989487-102989509 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1045574981 8:103410615-103410637 CCAAAAAGGTTAGGGACCACTGG + Intronic
1045698176 8:104834820-104834842 CCAAAAATGTTGGGGACCACTGG + Intronic
1045981878 8:108199450-108199472 CCAAAACGATTGGGGACTGCTGG - Intergenic
1046071877 8:109265629-109265651 CCAAAAAAGTTGGGGACCACTGG - Intronic
1046349346 8:112986025-112986047 CCAAAAATGTTGGGGACTACTGG + Intronic
1046357393 8:113106511-113106533 CCAAAAAGGTTGTGGAGCAGGGG + Intronic
1046893991 8:119452947-119452969 CCAAAAAACTTGGGGACCCTGGG + Intergenic
1048140044 8:131785548-131785570 TCCAAAAGGTTGAGGACCGCTGG - Intergenic
1048434346 8:134402029-134402051 CTAAAAAGGTTGGAGACCACTGG + Intergenic
1048583455 8:135750188-135750210 CCAAAAAGGTTGGGAACTGCTGG + Intergenic
1050088589 9:1992809-1992831 CCAAACGGGTTGGGGACTGCTGG - Intergenic
1050131227 9:2414921-2414943 CCAAAAAGTTTGGGGATCACTGG - Intergenic
1050223792 9:3426953-3426975 CCAAAAAGGTTGGGGACCACTGG + Intronic
1050289519 9:4139597-4139619 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1050393967 9:5176020-5176042 CCAAAAAGGTTGGGGATTACTGG + Intronic
1050659014 9:7862622-7862644 CCAAAAACGTTGAGGACCTCTGG + Intronic
1050712038 9:8476107-8476129 CCAAAAAGGCTCGGAACCACTGG - Intronic
1050848599 9:10256211-10256233 CCAAAAAGGTTGGGGGCTGCTGG + Intronic
1050923985 9:11240611-11240633 CCAAAAAGAATGGGGACCACTGG + Intergenic
1051628675 9:19122887-19122909 CCATAAAGCTTGGGGACCACTGG + Intronic
1051682007 9:19617048-19617070 TAGAAAAGCTTGGGGACCGCTGG - Intronic
1052202432 9:25799183-25799205 CCAAAAAAGTTGGGGACCGTTGG + Intergenic
1052409623 9:28106213-28106235 CCAAAAAGATTGGGGACTGCTGG + Intronic
1052512094 9:29435032-29435054 CCAAAAAGGTTGGAGACCGCTGG - Intergenic
1053136594 9:35654662-35654684 CCAAAACGGCTGGGGACCAGTGG - Intergenic
1053406044 9:37877005-37877027 CCAAAAAGGTTGGGGACCACTGG - Intronic
1054978635 9:71177411-71177433 CCAAAAAGGTTGGGGACCTCTGG + Intronic
1055354971 9:75428345-75428367 CCAAAAAGGTTAGGGACTGCTGG + Intergenic
1055416571 9:76090665-76090687 CCAAAAAAGTTGAGAACCGCTGG - Intronic
1055743535 9:79416368-79416390 TCAAAAAGGCTGGGGACTGTTGG + Intergenic
1055767895 9:79684649-79684671 CCAAAAAGATTGGGGACTGCTGG + Intronic
1056306737 9:85298183-85298205 CCAAAAGTGTTGGGGACCACTGG - Intergenic
1056599657 9:88036719-88036741 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1057029223 9:91761216-91761238 CTAAAAAGACTGGGGACCACTGG - Intronic
1057450314 9:95152837-95152859 CCAAAAAGATTGGACATCGCTGG - Intronic
1057586345 9:96332004-96332026 CTAAAAAGGTTGGGGACTGCTGG + Intronic
1057607602 9:96511598-96511620 CCCAGAAGGCTTGGGACCGCTGG - Intronic
1058044050 9:100336752-100336774 GCAAAATGGTTGGGGACCGTTGG + Intronic
1058131057 9:101254040-101254062 CCAAAAATGTTGGGGACTGCTGG - Intronic
1058779328 9:108317578-108317600 CCAAGATAGTTGGGGACCGCTGG + Intergenic
1060126143 9:121048566-121048588 CCAAAATGGTTGGGGACTGCTGG + Intronic
1060345943 9:122815948-122815970 CCAAAAAGGTTGGGGACCACTGG - Intronic
1061360793 9:130141075-130141097 CCAACAAGGTTGGAGTCAGCAGG - Intergenic
1203427852 Un_GL000195v1:58043-58065 CCAAACAGTCTGAGGACCGCTGG - Intergenic
1185521925 X:746884-746906 CCAAAAAGGCTGGGGACCGCTGG - Intergenic
1185546525 X:949955-949977 CCAAAAAGGCTGAAGACAGCTGG - Intergenic
1185720445 X:2377084-2377106 CCAGAAAGGCTGGGGACGGCTGG - Intronic
1185728128 X:2439430-2439452 CCAAAAAGCTTGAGGACCACTGG - Intronic
1185742434 X:2544622-2544644 CCAAGAAGTTTGGGGACCACTGG + Intergenic
1185785018 X:2883586-2883608 CCAAAAAGGTTGGGGATCACTGG - Intergenic
1185837497 X:3358732-3358754 CCAAAAAGGTTGAGGACTGCTGG + Intergenic
1185865557 X:3620714-3620736 CCAAAAAGGTCGGGGACCGCTGG + Intronic
1186050204 X:5584424-5584446 CCAAAAAGATTGGGGACAGCTGG - Intergenic
1186204779 X:7189981-7190003 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1186344213 X:8674840-8674862 CCTAAAATGTGGGGGACCCCAGG + Intronic
1186510400 X:10125829-10125851 CCAAAAAGGTGGGGAGCAGCAGG + Intronic
1186592313 X:10944043-10944065 CCAAAAAGGTTGGAGACCTCTGG - Intergenic
1186644192 X:11488874-11488896 CCAAAAAGGTTGGGGACCGCTGG + Intronic
1186668619 X:11745842-11745864 CCACAAAGATTGGGGACTGCTGG - Intergenic
1187401936 X:18967879-18967901 CCAAAAAGTTTGAGAACTGCTGG - Intronic
1187542192 X:20208015-20208037 TAAAAAAGGTTGGGGATCACTGG - Intronic
1188065652 X:25656348-25656370 CCTAAAAGGTTGGGGATCACTGG - Intergenic
1188292867 X:28410352-28410374 CCAAAAAGATTGGGGAGGCCGGG + Intergenic
1188313500 X:28646066-28646088 CCTAAAAGGTTGGGGACCACTGG - Intronic
1188333811 X:28903015-28903037 CCAAAAAGATTGAGGGCCACTGG + Intronic
1188741667 X:33790807-33790829 CCAAAAAGGTTGAGGACCACTGG + Intergenic
1189453164 X:41158666-41158688 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1189587587 X:42476656-42476678 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1189843365 X:45106070-45106092 CTAAAAAGGTTGGGGACCGCTGG + Intronic
1190037662 X:47040706-47040728 CCAAAAAGGCTGGGGACCACTGG + Intronic
1190134135 X:47779625-47779647 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1191764403 X:64681775-64681797 CCAAAAAGGTTAGGGAACACTGG - Intergenic
1191895976 X:65993879-65993901 CCAAAAAGGGTTTGGACTGCGGG + Intergenic
1192590894 X:72358711-72358733 CCAAAAAGGTTGGGGACTGCTGG - Intronic
1192606537 X:72524907-72524929 CCAAAAAGGTTGGGGGCTGGTGG - Intronic
1193669641 X:84368731-84368753 CCAAAAATGTTGGGGACTGCTGG - Intronic
1193932708 X:87575468-87575490 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1194561822 X:95431109-95431131 CCAAAAAGGTTAGGGGCCACTGG - Intergenic
1194601049 X:95922566-95922588 CCAAAAAGGTTGGGGACTGCTGG - Intergenic
1194818431 X:98474251-98474273 ACAGAAAGGTTGGGGATCACTGG + Intergenic
1195341882 X:103914573-103914595 CCAGAAAGGTTGGGGACCGCTGG - Intergenic
1195349389 X:103982452-103982474 CCAGAAAGGTTGGGGACCGCTGG + Intergenic
1195351381 X:103999870-103999892 CCAGGAAGGCTGGGGACCACTGG - Intergenic
1195356750 X:104046544-104046566 TCAAAAAGGTTGGGGACCGCTGG + Intergenic
1195358054 X:104056387-104056409 CCAGAAAGGTTGGGGACCGCTGG - Intergenic
1195423266 X:104699108-104699130 TAAAAAAGGTTGGGGACCGCTGG - Intronic
1195944183 X:110191800-110191822 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1196032746 X:111108705-111108727 CAAAAAAGGTTGAGGACTGCTGG + Intronic
1196786940 X:119428990-119429012 CCAAAAAGGTTAGGGACTGCTGG + Intronic
1197150286 X:123213214-123213236 CCAAAAAGGTTGAGAACTGCTGG + Intronic
1197401103 X:125992082-125992104 TTCAAAAGGTTGGGGACCACTGG - Intergenic
1197447790 X:126572258-126572280 TCAAAAAGGTTGGAGACCGCTGG + Intergenic
1197654809 X:129105562-129105584 TCAAAAAGGTTGGGGACCACTGG - Intergenic
1198066814 X:133106301-133106323 CCAAAAAGGTTGGGGACTGCTGG + Intergenic
1198377367 X:136053067-136053089 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1198395584 X:136215688-136215710 CCAAAAAGGTTGGGGACTGCTGG + Intronic
1198797476 X:140414349-140414371 CCAAAATGGTTGGGGACCACTGG - Intergenic
1200755028 Y:6983040-6983062 CCAAAAAGGTTGGGCACCGCTGG + Intronic
1200798145 Y:7360761-7360783 CCAAAAAGGTTGGGGACCACTGG - Intergenic
1200841079 Y:7782411-7782433 CCAAAAAGGTTGGGGACCACTGG + Intergenic
1201238320 Y:11933076-11933098 CCAAAAAAGTTGAGGACTGCTGG - Intergenic
1201948983 Y:19542301-19542323 CCAAAAAGATTGGCAAGCGCAGG + Intergenic