ID: 1004373745

View in Genome Browser
Species Human (GRCh38)
Location 6:15074557-15074579
Sequence CGCTGGTGCCAAAAAGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5106
Summary {0: 8, 1: 1048, 2: 1641, 3: 1334, 4: 1075}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373745_1004373754 15 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373754 6:15074595-15074617 GATAATTTTTCCACAGATGGAGG No data
1004373745_1004373756 19 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG No data
1004373745_1004373758 21 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373758 6:15074601-15074623 TTTTCCACAGATGGAGGGTGGGG No data
1004373745_1004373750 -9 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373750 6:15074571-15074593 GCACCAGCGACCAGTTTTGTGGG No data
1004373745_1004373759 22 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373745_1004373755 16 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373755 6:15074596-15074618 ATAATTTTTCCACAGATGGAGGG No data
1004373745_1004373757 20 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373757 6:15074600-15074622 TTTTTCCACAGATGGAGGGTGGG No data
1004373745_1004373753 12 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373753 6:15074592-15074614 GGAGATAATTTTTCCACAGATGG No data
1004373745_1004373749 -10 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373745 Original CRISPR CGCTGGTGCCAAAAAGGTTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr