ID: 1004373747

View in Genome Browser
Species Human (GRCh38)
Location 6:15074559-15074581
Sequence GTCGCTGGTGCCAAAAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373747_1004373753 10 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373753 6:15074592-15074614 GGAGATAATTTTTCCACAGATGG No data
1004373747_1004373758 19 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373758 6:15074601-15074623 TTTTCCACAGATGGAGGGTGGGG No data
1004373747_1004373759 20 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373747_1004373755 14 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373755 6:15074596-15074618 ATAATTTTTCCACAGATGGAGGG No data
1004373747_1004373761 30 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373761 6:15074612-15074634 TGGAGGGTGGGGGTCGTTTCAGG No data
1004373747_1004373754 13 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373754 6:15074595-15074617 GATAATTTTTCCACAGATGGAGG No data
1004373747_1004373756 17 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG No data
1004373747_1004373757 18 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373757 6:15074600-15074622 TTTTTCCACAGATGGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373747 Original CRISPR GTCGCTGGTGCCAAAAAGGT TGG (reversed) Intergenic
No off target data available for this crispr