ID: 1004373749

View in Genome Browser
Species Human (GRCh38)
Location 6:15074570-15074592
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373740_1004373749 21 Left 1004373740 6:15074526-15074548 CCTCGCGTTCTGAAGGCTCTAAG No data
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data
1004373745_1004373749 -10 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data
1004373743_1004373749 -2 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373749 6:15074570-15074592 GGCACCAGCGACCAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373749 Original CRISPR GGCACCAGCGACCAGTTTTG TGG Intergenic
No off target data available for this crispr