ID: 1004373752

View in Genome Browser
Species Human (GRCh38)
Location 6:15074581-15074603
Sequence AAAATTATCTCCCACAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373752_1004373756 -5 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG No data
1004373752_1004373759 -2 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373752_1004373757 -4 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373757 6:15074600-15074622 TTTTTCCACAGATGGAGGGTGGG No data
1004373752_1004373761 8 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373761 6:15074612-15074634 TGGAGGGTGGGGGTCGTTTCAGG No data
1004373752_1004373755 -8 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373755 6:15074596-15074618 ATAATTTTTCCACAGATGGAGGG No data
1004373752_1004373762 11 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373762 6:15074615-15074637 AGGGTGGGGGTCGTTTCAGGAGG No data
1004373752_1004373754 -9 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373754 6:15074595-15074617 GATAATTTTTCCACAGATGGAGG No data
1004373752_1004373758 -3 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373758 6:15074601-15074623 TTTTCCACAGATGGAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373752 Original CRISPR AAAATTATCTCCCACAAAAC TGG (reversed) Intergenic
No off target data available for this crispr