ID: 1004373759

View in Genome Browser
Species Human (GRCh38)
Location 6:15074602-15074624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004373743_1004373759 30 Left 1004373743 6:15074549-15074571 CCGGCGGTCCCCAACCTTTTTGG 0: 35
1: 211
2: 351
3: 263
4: 247
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373747_1004373759 20 Left 1004373747 6:15074559-15074581 CCAACCTTTTTGGCACCAGCGAC No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373746_1004373759 21 Left 1004373746 6:15074558-15074580 CCCAACCTTTTTGGCACCAGCGA No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373745_1004373759 22 Left 1004373745 6:15074557-15074579 CCCCAACCTTTTTGGCACCAGCG 0: 8
1: 1048
2: 1641
3: 1334
4: 1075
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373751_1004373759 5 Left 1004373751 6:15074574-15074596 CCAGCGACCAGTTTTGTGGGAGA No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373748_1004373759 16 Left 1004373748 6:15074563-15074585 CCTTTTTGGCACCAGCGACCAGT No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data
1004373752_1004373759 -2 Left 1004373752 6:15074581-15074603 CCAGTTTTGTGGGAGATAATTTT No data
Right 1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004373759 Original CRISPR TTTCCACAGATGGAGGGTGG GGG Intergenic
No off target data available for this crispr