ID: 1004381340

View in Genome Browser
Species Human (GRCh38)
Location 6:15135209-15135231
Sequence GTCCTTGGTTACCACCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004381333_1004381340 2 Left 1004381333 6:15135184-15135206 CCTCCCACCACGTCTCTTGTGGG No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381337_1004381340 -2 Left 1004381337 6:15135188-15135210 CCACCACGTCTCTTGTGGGGTGT No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381326_1004381340 30 Left 1004381326 6:15135156-15135178 CCTCTCTCCCCACTCCTGCCGCG No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381330_1004381340 16 Left 1004381330 6:15135170-15135192 CCTGCCGCGTCAGTCCTCCCACC No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381331_1004381340 12 Left 1004381331 6:15135174-15135196 CCGCGTCAGTCCTCCCACCACGT No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381328_1004381340 22 Left 1004381328 6:15135164-15135186 CCCACTCCTGCCGCGTCAGTCCT No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381336_1004381340 -1 Left 1004381336 6:15135187-15135209 CCCACCACGTCTCTTGTGGGGTG No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381329_1004381340 21 Left 1004381329 6:15135165-15135187 CCACTCCTGCCGCGTCAGTCCTC No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381338_1004381340 -5 Left 1004381338 6:15135191-15135213 CCACGTCTCTTGTGGGGTGTCCT No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data
1004381327_1004381340 23 Left 1004381327 6:15135163-15135185 CCCCACTCCTGCCGCGTCAGTCC No data
Right 1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004381340 Original CRISPR GTCCTTGGTTACCACCCTCC CGG Intergenic
No off target data available for this crispr