ID: 1004381581

View in Genome Browser
Species Human (GRCh38)
Location 6:15137368-15137390
Sequence TTGTGTTGTAAAGAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004381578_1004381581 16 Left 1004381578 6:15137329-15137351 CCTGAACTTGAATCTGGACTTCC No data
Right 1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG No data
1004381577_1004381581 20 Left 1004381577 6:15137325-15137347 CCAGCCTGAACTTGAATCTGGAC No data
Right 1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG No data
1004381579_1004381581 -5 Left 1004381579 6:15137350-15137372 CCTTTGTCTACTATTTCCTTGTG No data
Right 1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004381581 Original CRISPR TTGTGTTGTAAAGAAGCTGC TGG Intergenic
No off target data available for this crispr