ID: 1004387211

View in Genome Browser
Species Human (GRCh38)
Location 6:15183534-15183556
Sequence AAAAAGAAGAAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004387211_1004387216 25 Left 1004387211 6:15183534-15183556 CCAGCCTCCTTCTTCTTCTTTTT No data
Right 1004387216 6:15183582-15183604 TCTCCCTTTGTCTCCCAGGCTGG 0: 21
1: 710
2: 15512
3: 134595
4: 222738
1004387211_1004387215 21 Left 1004387211 6:15183534-15183556 CCAGCCTCCTTCTTCTTCTTTTT No data
Right 1004387215 6:15183578-15183600 GGAGTCTCCCTTTGTCTCCCAGG 0: 4
1: 281
2: 7110
3: 71452
4: 136416
1004387211_1004387214 0 Left 1004387211 6:15183534-15183556 CCAGCCTCCTTCTTCTTCTTTTT No data
Right 1004387214 6:15183557-15183579 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004387211 Original CRISPR AAAAAGAAGAAGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr