ID: 1004388737

View in Genome Browser
Species Human (GRCh38)
Location 6:15191535-15191557
Sequence AGCCCTAGGAAAGGTGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004388737_1004388742 3 Left 1004388737 6:15191535-15191557 CCAAAGACACCTTTCCTAGGGCT No data
Right 1004388742 6:15191561-15191583 ACAACAAACTACCACACACTGGG No data
1004388737_1004388741 2 Left 1004388737 6:15191535-15191557 CCAAAGACACCTTTCCTAGGGCT No data
Right 1004388741 6:15191560-15191582 CACAACAAACTACCACACACTGG No data
1004388737_1004388743 6 Left 1004388737 6:15191535-15191557 CCAAAGACACCTTTCCTAGGGCT No data
Right 1004388743 6:15191564-15191586 ACAAACTACCACACACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004388737 Original CRISPR AGCCCTAGGAAAGGTGTCTT TGG (reversed) Intergenic
No off target data available for this crispr