ID: 1004389480

View in Genome Browser
Species Human (GRCh38)
Location 6:15198059-15198081
Sequence CAGAAGAAGGAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004389474_1004389480 -1 Left 1004389474 6:15198037-15198059 CCTGAGTACCGTGAACACAATTC No data
Right 1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG No data
1004389472_1004389480 15 Left 1004389472 6:15198021-15198043 CCTCTGACAGTTGTACCCTGAGT No data
Right 1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG No data
1004389473_1004389480 0 Left 1004389473 6:15198036-15198058 CCCTGAGTACCGTGAACACAATT No data
Right 1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG No data
1004389475_1004389480 -9 Left 1004389475 6:15198045-15198067 CCGTGAACACAATTCAGAAGAAG No data
Right 1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004389480 Original CRISPR CAGAAGAAGGAGAAGGGGCA TGG Intergenic
No off target data available for this crispr