ID: 1004394023

View in Genome Browser
Species Human (GRCh38)
Location 6:15232641-15232663
Sequence TGTAGTCCCAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801512
Summary {0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394023_1004394033 28 Left 1004394023 6:15232641-15232663 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1004394033 6:15232692-15232714 TTTGTATCTTTAGGAGAGGCAGG No data
1004394023_1004394034 29 Left 1004394023 6:15232641-15232663 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394023_1004394031 19 Left 1004394023 6:15232641-15232663 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1004394031 6:15232683-15232705 AGCTAATTTTTTGTATCTTTAGG No data
1004394023_1004394032 24 Left 1004394023 6:15232641-15232663 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1004394032 6:15232688-15232710 ATTTTTTGTATCTTTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394023 Original CRISPR TGTAGTCCCAGCTACTCGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr