ID: 1004394025

View in Genome Browser
Species Human (GRCh38)
Location 6:15232644-15232666
Sequence ACCTGTAGTCCCAGCTACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 765008
Summary {0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394025_1004394034 26 Left 1004394025 6:15232644-15232666 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394025_1004394033 25 Left 1004394025 6:15232644-15232666 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1004394033 6:15232692-15232714 TTTGTATCTTTAGGAGAGGCAGG No data
1004394025_1004394032 21 Left 1004394025 6:15232644-15232666 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1004394032 6:15232688-15232710 ATTTTTTGTATCTTTAGGAGAGG No data
1004394025_1004394031 16 Left 1004394025 6:15232644-15232666 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1004394031 6:15232683-15232705 AGCTAATTTTTTGTATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394025 Original CRISPR ACCTGTAGTCCCAGCTACTC GGG (reversed) Intergenic
Too many off-targets to display for this crispr