ID: 1004394026

View in Genome Browser
Species Human (GRCh38)
Location 6:15232645-15232667
Sequence CACCTGTAGTCCCAGCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 580448
Summary {0: 27099, 1: 99923, 2: 128146, 3: 148395, 4: 176885}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394026_1004394033 24 Left 1004394026 6:15232645-15232667 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1004394033 6:15232692-15232714 TTTGTATCTTTAGGAGAGGCAGG No data
1004394026_1004394031 15 Left 1004394026 6:15232645-15232667 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1004394031 6:15232683-15232705 AGCTAATTTTTTGTATCTTTAGG No data
1004394026_1004394032 20 Left 1004394026 6:15232645-15232667 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1004394032 6:15232688-15232710 ATTTTTTGTATCTTTAGGAGAGG No data
1004394026_1004394034 25 Left 1004394026 6:15232645-15232667 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394026 Original CRISPR CACCTGTAGTCCCAGCTACT CGG (reversed) Intergenic
Too many off-targets to display for this crispr