ID: 1004394027

View in Genome Browser
Species Human (GRCh38)
Location 6:15232672-15232694
Sequence AAAAAATTAGCTGGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 599356
Summary {0: 12741, 1: 68316, 2: 142002, 3: 198072, 4: 178225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394027_1004394034 -2 Left 1004394027 6:15232672-15232694 CCACCATGCCCAGCTAATTTTTT 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394027_1004394032 -7 Left 1004394027 6:15232672-15232694 CCACCATGCCCAGCTAATTTTTT 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225
Right 1004394032 6:15232688-15232710 ATTTTTTGTATCTTTAGGAGAGG No data
1004394027_1004394033 -3 Left 1004394027 6:15232672-15232694 CCACCATGCCCAGCTAATTTTTT 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225
Right 1004394033 6:15232692-15232714 TTTGTATCTTTAGGAGAGGCAGG No data
1004394027_1004394035 17 Left 1004394027 6:15232672-15232694 CCACCATGCCCAGCTAATTTTTT 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225
Right 1004394035 6:15232712-15232734 AGGGTTTCACCATGTTAGCCAGG 0: 5092
1: 58703
2: 171190
3: 192556
4: 152510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394027 Original CRISPR AAAAAATTAGCTGGGCATGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr