ID: 1004394028

View in Genome Browser
Species Human (GRCh38)
Location 6:15232675-15232697
Sequence TACAAAAAATTAGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235030
Summary {0: 6108, 1: 20643, 2: 47272, 3: 60094, 4: 100913}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394028_1004394032 -10 Left 1004394028 6:15232675-15232697 CCATGCCCAGCTAATTTTTTGTA 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
Right 1004394032 6:15232688-15232710 ATTTTTTGTATCTTTAGGAGAGG No data
1004394028_1004394033 -6 Left 1004394028 6:15232675-15232697 CCATGCCCAGCTAATTTTTTGTA 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
Right 1004394033 6:15232692-15232714 TTTGTATCTTTAGGAGAGGCAGG No data
1004394028_1004394034 -5 Left 1004394028 6:15232675-15232697 CCATGCCCAGCTAATTTTTTGTA 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394028_1004394035 14 Left 1004394028 6:15232675-15232697 CCATGCCCAGCTAATTTTTTGTA 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
Right 1004394035 6:15232712-15232734 AGGGTTTCACCATGTTAGCCAGG 0: 5092
1: 58703
2: 171190
3: 192556
4: 152510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394028 Original CRISPR TACAAAAAATTAGCTGGGCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr