ID: 1004394029

View in Genome Browser
Species Human (GRCh38)
Location 6:15232680-15232702
Sequence AAAGATACAAAAAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186903
Summary {0: 372, 1: 20905, 2: 70190, 3: 47624, 4: 47812}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394029_1004394034 -10 Left 1004394029 6:15232680-15232702 CCCAGCTAATTTTTTGTATCTTT 0: 372
1: 20905
2: 70190
3: 47624
4: 47812
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394029_1004394035 9 Left 1004394029 6:15232680-15232702 CCCAGCTAATTTTTTGTATCTTT 0: 372
1: 20905
2: 70190
3: 47624
4: 47812
Right 1004394035 6:15232712-15232734 AGGGTTTCACCATGTTAGCCAGG 0: 5092
1: 58703
2: 171190
3: 192556
4: 152510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394029 Original CRISPR AAAGATACAAAAAATTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr