ID: 1004394034

View in Genome Browser
Species Human (GRCh38)
Location 6:15232693-15232715
Sequence TTGTATCTTTAGGAGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004394026_1004394034 25 Left 1004394026 6:15232645-15232667 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394027_1004394034 -2 Left 1004394027 6:15232672-15232694 CCACCATGCCCAGCTAATTTTTT 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394029_1004394034 -10 Left 1004394029 6:15232680-15232702 CCCAGCTAATTTTTTGTATCTTT 0: 372
1: 20905
2: 70190
3: 47624
4: 47812
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394025_1004394034 26 Left 1004394025 6:15232644-15232666 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394028_1004394034 -5 Left 1004394028 6:15232675-15232697 CCATGCCCAGCTAATTTTTTGTA 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data
1004394023_1004394034 29 Left 1004394023 6:15232641-15232663 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004394034 Original CRISPR TTGTATCTTTAGGAGAGGCA GGG Intergenic
No off target data available for this crispr