ID: 1004395456

View in Genome Browser
Species Human (GRCh38)
Location 6:15244018-15244040
Sequence TAGTGGTGATCAAACCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004395456_1004395459 -9 Left 1004395456 6:15244018-15244040 CCCCACAGGTTTGATCACCACTA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1004395459 6:15244032-15244054 TCACCACTAATTTGCAGATGCGG 0: 1
1: 0
2: 4
3: 66
4: 563
1004395456_1004395463 30 Left 1004395456 6:15244018-15244040 CCCCACAGGTTTGATCACCACTA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1004395463 6:15244071-15244093 AGAGGCTCTCGGTTGCCTTTTGG 0: 1
1: 0
2: 3
3: 20
4: 150
1004395456_1004395461 12 Left 1004395456 6:15244018-15244040 CCCCACAGGTTTGATCACCACTA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1004395461 6:15244053-15244075 GGAAACTGACAAGCTCAGAGAGG 0: 1
1: 0
2: 7
3: 59
4: 386
1004395456_1004395462 19 Left 1004395456 6:15244018-15244040 CCCCACAGGTTTGATCACCACTA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1004395462 6:15244060-15244082 GACAAGCTCAGAGAGGCTCTCGG 0: 1
1: 0
2: 1
3: 19
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004395456 Original CRISPR TAGTGGTGATCAAACCTGTG GGG (reversed) Intergenic
904088154 1:27925559-27925581 AAGTAGTGATGAAACCTGGGAGG - Intergenic
905022442 1:34827116-34827138 TGGTGGTGTTCAGAGCTGTGAGG - Intronic
909231213 1:73093093-73093115 CAGTGGTGATGAATCCTGTCAGG + Intergenic
912685610 1:111760260-111760282 TACTGGTGATGAAACGTGAGGGG + Intronic
915617819 1:157054548-157054570 TAGTGGTGTTCAAGCCTTTATGG + Intergenic
917662719 1:177193285-177193307 TATTGCTGATCAAAACTGTTTGG - Intronic
920138476 1:203789962-203789984 CAGTGGTGATGAACACTGTGGGG + Intergenic
1065542487 10:26784186-26784208 GAGTAGTGATCAAAGTTGTGTGG - Intronic
1072043410 10:91631191-91631213 CAGTGGTCCTCAAACCTGTCTGG + Intronic
1072177205 10:92939081-92939103 TAGTGGTGATTAAACTGATGAGG + Intronic
1074360023 10:112818205-112818227 TAATGGTGAACAAAATTGTGCGG + Exonic
1080155957 11:29111329-29111351 TAAAGGTGGTCAAACCAGTGAGG + Intergenic
1083064619 11:59912064-59912086 TAGTGGTTACCAGACTTGTGGGG - Intergenic
1085536563 11:77223959-77223981 TAGTGGTGAGCAAGGCTCTGTGG + Intronic
1086801340 11:91180309-91180331 TAGAGGTATTAAAACCTGTGGGG + Intergenic
1087892434 11:103550598-103550620 AAGTGGAGAGCAAAGCTGTGGGG + Intergenic
1092741053 12:11630016-11630038 TTGTTGTCATGAAACCTGTGTGG + Intergenic
1104267310 12:127245510-127245532 TAGTGGTGATAACACCCTTGTGG - Intergenic
1106953964 13:34915149-34915171 CAGTGGTTCTCAACCCTGTGTGG + Intergenic
1112495986 13:99905140-99905162 TAGTTGTGATCAAAGCTTTCTGG - Intergenic
1112812567 13:103235192-103235214 CTGTGCTAATCAAACCTGTGAGG + Intergenic
1118775432 14:68970952-68970974 TCATGGTGAGCAAACTTGTGAGG - Intronic
1118908660 14:70043123-70043145 TTGTGGTGATCAAAGCTGTGAGG + Intergenic
1121073673 14:91048697-91048719 TAGGAGTGATCATACCTTTGAGG + Intronic
1122615446 14:103014634-103014656 TTGTGGTGATCGAACCTCAGTGG - Intronic
1127649579 15:60994160-60994182 GAGTGGTTATCTAAGCTGTGTGG + Intronic
1130911553 15:88274513-88274535 TAGTGGGGAACAAACCTATAAGG + Intergenic
1137998066 16:53241818-53241840 CAGTTGTGATGAAACCTGTCTGG - Intronic
1141031811 16:80595790-80595812 TAGTGAAGGTCAAAGCTGTGGGG - Intergenic
1146499072 17:33348786-33348808 TAGTGGTGGTCAAAGGGGTGGGG + Intronic
1146849056 17:36206229-36206251 TAGTGGTGGTCAAGGATGTGGGG + Intronic
1150647920 17:66991444-66991466 TAGTGCTGAGCAAAGCAGTGGGG + Intronic
1151192583 17:72409165-72409187 TGTTGGTGACCAAATCTGTGGGG + Intergenic
1153475771 18:5497075-5497097 CAGTGGCGATAAAGCCTGTGAGG + Intronic
1157897000 18:51478815-51478837 CACTGGTGAACAAAGCTGTGAGG + Intergenic
1165286095 19:34843328-34843350 TAGTGGTTACCAGAGCTGTGGGG - Intergenic
1165351342 19:35277585-35277607 TAATGGTGATGAAACCGGTCAGG - Intronic
929470139 2:42183419-42183441 TGGTGGTGATACAACCTGTGTGG + Intronic
930294151 2:49532379-49532401 TAGTGGTGATGAATCCTCTCAGG - Intergenic
936242752 2:110801841-110801863 TAGTTGTCAACAAACCTGTACGG - Intronic
947239617 2:227979628-227979650 TTTTGGTTATCACACCTGTGAGG + Intergenic
1171800878 20:29615786-29615808 TACTGGTGATGGAACATGTGGGG + Intergenic
1172166378 20:32902241-32902263 TGGTGGTGAACACACCAGTGAGG + Intronic
1177000439 21:15605656-15605678 TAGTGTTTTTCAAACCTGTCAGG - Intergenic
1177976464 21:27857639-27857661 TAGCAGTGATGAAACCTCTGAGG + Intergenic
1178559317 21:33623363-33623385 TAATGGTTATGAAAACTGTGTGG - Intronic
1183051211 22:35263085-35263107 TGATGGTGATCATACCTTTGAGG + Exonic
1183731626 22:39621749-39621771 TAGTGGGAACCAAAGCTGTGCGG + Intronic
951922343 3:27870283-27870305 TAGTGGTGAGCAAAACAGTGGGG + Intergenic
953414865 3:42709784-42709806 TAGAGGTGGGCAGACCTGTGGGG + Exonic
959491868 3:106999639-106999661 AAGTGTTTAACAAACCTGTGTGG - Intergenic
961407538 3:126692334-126692356 CAGTGATTATCAAACCTGAGGGG + Intergenic
962449340 3:135498996-135499018 TATTGCTAATCAAAGCTGTGTGG - Intergenic
965483194 3:169245615-169245637 TAGTGGAGAACAAAACTGAGAGG + Intronic
973105380 4:46329462-46329484 TGGTGGTGAAGAAACATGTGAGG - Intronic
973927881 4:55758294-55758316 GAGTGGTGATTAAGCCTGTTCGG - Intergenic
976415232 4:84765710-84765732 TAATGGTGATCAAACCGCAGAGG + Intronic
988429861 5:31106975-31106997 AAGTGATGATCAACCCAGTGGGG - Intergenic
1002871690 6:1171851-1171873 TAGTGAAGTTCAAACCTGTATGG - Intergenic
1004395456 6:15244018-15244040 TAGTGGTGATCAAACCTGTGGGG - Intergenic
1004743965 6:18491592-18491614 CAGTGGTCATTCAACCTGTGCGG - Intergenic
1010618283 6:78041428-78041450 TAGTGGTGAGAAAAAATGTGGGG - Intergenic
1013272168 6:108555524-108555546 GCGTGGTGATGAAACCTGTCTGG + Intergenic
1013388965 6:109664263-109664285 TAGTGGTTCTCAAACTTTTGGGG - Intronic
1016808874 6:148240248-148240270 AAGTGTTGATCAACACTGTGTGG - Intergenic
1018788186 6:167125264-167125286 TACTGGTAATAAAAACTGTGTGG - Intronic
1024757240 7:52549391-52549413 TAGTGGCCATGAAACCTATGAGG - Intergenic
1025015132 7:55433244-55433266 TAGTGTTTTTCAAACGTGTGTGG - Exonic
1027650205 7:80857072-80857094 TATTGGTGATGAAATTTGTGAGG - Intronic
1035190616 7:157164813-157164835 AGGTGGTGACAAAACCTGTGAGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1040823784 8:51595133-51595155 TACTGATGATCAAACTTTTGGGG + Intronic
1048482223 8:134809066-134809088 TATTGGTGCTTAGACCTGTGAGG + Intergenic
1050310484 9:4347809-4347831 TAGTTGTGTTCAAGCCTGTCAGG - Intronic
1050416367 9:5421418-5421440 TAGTGGTGATGAGTTCTGTGAGG - Intronic
1050791598 9:9477958-9477980 CAGTGGTTATCAATCCTGGGTGG - Intronic
1050826534 9:9952952-9952974 TACTGCTTCTCAAACCTGTGGGG + Intronic
1052037524 9:23699764-23699786 TAGTGGTGATCAGACTAGTGTGG - Intronic
1055572959 9:77634994-77635016 TAATAGTGACCAAACGTGTGTGG - Intronic
1060241244 9:121905086-121905108 TAGTGGTGATCCAAGTTGCGGGG + Intronic
1187995723 X:24924548-24924570 AAGGGGTGATAAAACCAGTGAGG + Intronic
1188377520 X:29450384-29450406 TAGTTGTGATCAAGAGTGTGTGG - Intronic
1189110855 X:38287018-38287040 TAGAGGGGATGGAACCTGTGAGG - Exonic
1195455851 X:105068961-105068983 CAGTTGTGATCACAACTGTGAGG - Intronic
1196797912 X:119516979-119517001 TAGTGGCAAACAAAACTGTGTGG + Intergenic
1199783522 X:151083856-151083878 GAGTGGCCATGAAACCTGTGGGG - Intergenic