ID: 1004396121

View in Genome Browser
Species Human (GRCh38)
Location 6:15248122-15248144
Sequence TGCAAGCCCGTGGCTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004396116_1004396121 -10 Left 1004396116 6:15248109-15248131 CCGGGCGTCCGGCTGCAAGCCCG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 132
1004396115_1004396121 -4 Left 1004396115 6:15248103-15248125 CCGAGTCCGGGCGTCCGGCTGCA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004396121 Original CRISPR TGCAAGCCCGTGGCTGGCGG CGG Intronic
900135188 1:1114160-1114182 TGCAAGGCCGTGGGGGGAGGGGG - Intronic
900218824 1:1496144-1496166 TCCAAGCCTGTGGCTGGAGCTGG + Exonic
900226188 1:1534627-1534649 TCCAAGCCTGTGGCTGGAGCTGG + Exonic
900240743 1:1616148-1616170 TTCGTGCCCGTGGCTCGCGGAGG - Intronic
900371988 1:2336297-2336319 CGCGAGACCCTGGCTGGCGGGGG + Intronic
900472298 1:2860936-2860958 GGCAAGACCTTGGCTGTCGGCGG - Intergenic
901928025 1:12579253-12579275 TGCACGCCCGGGGCTGGCTCTGG + Intronic
902490410 1:16776872-16776894 TGCAAGCCTGTGGCCTGCAGGGG + Intronic
903169174 1:21541529-21541551 AGCAGCCCCGTGGCTGGCAGAGG - Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
913523646 1:119669714-119669736 TGCAGGCAGGTGGCTGGCGTAGG - Intronic
922242737 1:223766667-223766689 TGCAGGCCCATGGCGGGCGGTGG + Intronic
923530030 1:234805658-234805680 TGCAAGCCTGTGGCCTGCAGGGG - Intergenic
1062905880 10:1179491-1179513 TGCAAAACCGGGGCTGGAGGTGG + Exonic
1069642375 10:69964136-69964158 TGGCAGCCAGTGGCTGGGGGTGG + Intronic
1070480919 10:76882034-76882056 TGCAGCCCTGTGGCTGGAGGAGG - Intronic
1071565766 10:86670587-86670609 TTTAAGCCCCTGGCTGGCCGGGG - Intronic
1072227565 10:93384397-93384419 TGGGAGGCCGAGGCTGGCGGCGG + Intronic
1075702422 10:124478105-124478127 TGCAAGCCCGGGGCTTGGGAGGG - Intronic
1076994981 11:293411-293433 CCCCAGCCAGTGGCTGGCGGTGG + Exonic
1080291263 11:30674019-30674041 TGCAAGGCGGTAGCTGGGGGAGG + Intergenic
1089647022 11:119887000-119887022 TCCATGCCCTGGGCTGGCGGCGG + Intergenic
1094143394 12:27203997-27204019 AGCAAGACTGTGGCTGGGGGTGG + Intergenic
1102166561 12:110811496-110811518 TGCAAGCCCCTGGCTGGGCTGGG + Intergenic
1102854094 12:116277939-116277961 TGCCGGCCCGTGGCTGCCGTGGG + Intergenic
1105738827 13:23300595-23300617 TGCAAGCCGTTGCCTGGCCGAGG + Intronic
1106109411 13:26763267-26763289 TGCAAGCCCAGGGCTGCCTGAGG - Intergenic
1106555454 13:30804633-30804655 TGCAGGCAGGTGGCCGGCGGTGG + Intergenic
1107147207 13:37071303-37071325 TGGAAACCTGTGGCTGGTGGAGG - Intergenic
1113487126 13:110662378-110662400 TGCAACCCCGTGGCTGGGTTTGG + Intronic
1113586369 13:111468726-111468748 GGCCATCCCGTGGCTGGCGTGGG + Intergenic
1116161828 14:41276957-41276979 TGCAAGGACGTGGATGGAGGTGG + Intergenic
1121735599 14:96216003-96216025 TGCAGGCCTGTGTCTGGCAGAGG - Intronic
1122079337 14:99256258-99256280 TGCAAGTAGGTGGCTGGCTGGGG - Intronic
1122941254 14:104982423-104982445 TGCAAGGCTGTGGCTGGGGCGGG - Intergenic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1130147255 15:81283290-81283312 TTCAAGCCTGTGGCTGGAGCTGG + Intronic
1132988807 16:2782683-2782705 TGCACTCCCGTGGCTGTTGGGGG - Intergenic
1133018326 16:2955108-2955130 GGCAAGCCAGGGGCTGGTGGGGG - Intergenic
1133755147 16:8757124-8757146 TTCAAGCCTGGGGCTGGCTGGGG - Intronic
1135662417 16:24307939-24307961 TGCAAGCCCTGGGCTGCTGGAGG - Intronic
1141637501 16:85322284-85322306 TGAAAGCCCCGGGCGGGCGGGGG + Intergenic
1142070799 16:88090528-88090550 AGCCGGCCCGTGGCTGGCGTGGG + Intronic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142611092 17:1109482-1109504 TGCGGGGCCGCGGCTGGCGGAGG + Intronic
1143096943 17:4483212-4483234 TGCAAGCCCTTGGGTGGCCCTGG + Intronic
1143608977 17:8006826-8006848 TGCAAGCCAGAGGCTGGGAGAGG - Intronic
1144601402 17:16617877-16617899 GGCATGTCCGTGGCGGGCGGGGG + Intergenic
1144891969 17:18499503-18499525 TGCAAGGTCGTGGCTGGGAGGGG - Intergenic
1145140254 17:20444814-20444836 TGCAAGGTCGTGGCTGGGAGGGG + Intergenic
1149537652 17:57444786-57444808 GGAAAGCCCGGGGTTGGCGGGGG + Intronic
1155923482 18:31629270-31629292 TGCATTCCGGTGGCTGGGGGAGG + Intronic
1157478769 18:48039764-48039786 TGCAGGCTCGTGGCTAGCAGGGG - Intronic
1158588674 18:58762171-58762193 AGCAGGCCCGGGGCTGGTGGGGG + Intergenic
1160315151 18:77837154-77837176 TGCATGGTCGTGGCTGGCAGTGG - Intergenic
1161519950 19:4718392-4718414 TGGGAGCCCCTGGCTGGCGTGGG + Intronic
1163118236 19:15200707-15200729 CCCAAGGCCGGGGCTGGCGGGGG - Intronic
1165079830 19:33300899-33300921 AGCAGGCCCGTGGCAGGAGGAGG - Exonic
1165829776 19:38724630-38724652 TGCAGGCCCTGGGCTGGCCGGGG - Intronic
1166233485 19:41439723-41439745 TGCAAACCTGTGGCTAGTGGGGG - Intronic
1167377633 19:49120104-49120126 TGCAAGCCCGAGGCTGGCGACGG - Intronic
925131522 2:1497182-1497204 TGGAACCCAGTGGCTGGAGGAGG - Intronic
926751562 2:16202476-16202498 TGCCAGCCAGTGCCTGGCGAGGG - Intergenic
927859331 2:26550743-26550765 AGGAAGCCCGGGGCAGGCGGAGG - Intronic
927859669 2:26552813-26552835 TGGCAGCCGGTGGCTGGCTGTGG - Intronic
929218210 2:39437438-39437460 TGCCAGGCCGGGGCCGGCGGCGG + Intergenic
929501271 2:42493575-42493597 TGCCTGCCCGTGGCTGACGGGGG + Exonic
929527867 2:42722752-42722774 TGCAAGTCCTTGGCTGGCTCAGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933728166 2:85437956-85437978 TGCAAGCGGGAGGCTGGGGGCGG + Intergenic
936875128 2:117179920-117179942 TGCAAGGCCGTGACTGTTGGTGG - Intergenic
936972187 2:118186456-118186478 CGCAAGCCCGGAACTGGCGGAGG - Intergenic
937991400 2:127664300-127664322 ACCTACCCCGTGGCTGGCGGCGG + Exonic
941102210 2:161308656-161308678 GGAAAGCACGGGGCTGGCGGCGG - Intronic
1168855114 20:1002522-1002544 TGCGTACCTGTGGCTGGCGGTGG - Intergenic
1171151528 20:22830748-22830770 TCCAACCCCCTGGCTGGCTGTGG + Intergenic
1179098204 21:38334418-38334440 TTCAAGCCCCTGGCTGCCTGTGG - Intergenic
1179406788 21:41132782-41132804 TGCAATCCTGTGGCAGGAGGAGG + Intergenic
1181023035 22:20113403-20113425 GGCAAGGCCGTGGGTGGGGGTGG - Intronic
1182245016 22:28950268-28950290 TGCAAGCCCAGGGCAGGGGGCGG - Intronic
1183864102 22:40690569-40690591 TGCAAGCCCGAGGCTGGGGCTGG + Intergenic
1185023674 22:48395423-48395445 TGCGAGCCCGTGACTAGTGGCGG + Intergenic
954089287 3:48272004-48272026 TGCGAGCCCATGGCGGTCGGGGG + Intronic
954972757 3:54664823-54664845 GGCAAACCCGTGGCTGGAGGTGG + Intronic
959574170 3:107916556-107916578 TCCCAGCCCGTGGCTAGTGGAGG - Intergenic
961359010 3:126356112-126356134 GGCAAGCCCTTGGCCGGCGCTGG - Intronic
961504239 3:127359635-127359657 TGCCAGCCCCTGGCTTGCTGGGG - Intergenic
961592331 3:127990343-127990365 TGCAGGCCCGCGGCTGGAAGAGG - Intergenic
962318985 3:134375579-134375601 GGAAAGCCCCTGGCTGGCAGGGG - Intergenic
968912554 4:3483528-3483550 TGGGAGCCCGAGGCTGGCGGTGG + Intronic
968962861 4:3753939-3753961 TCCAAGACCGCGGCAGGCGGGGG + Intergenic
989049973 5:37309812-37309834 TGCAAGGCTGAGGCAGGCGGAGG + Intronic
991978229 5:72204002-72204024 TCCAAGGCCGTGGTTGGTGGTGG - Intronic
992550115 5:77851878-77851900 CGCAAGCCCCGGGCTGTCGGAGG - Intronic
997648136 5:135494670-135494692 TGCCAGCCAGTGGCTGGCCCAGG - Intergenic
1003153549 6:3572386-3572408 AGTAAGCACGTGGCTGGCTGTGG - Intergenic
1004396121 6:15248122-15248144 TGCAAGCCCGTGGCTGGCGGCGG + Intronic
1006780692 6:36630480-36630502 TGCAAGCAGGTGGCTGGCTCCGG + Intergenic
1013435569 6:110102019-110102041 TGCAAAGCAGTGGCTGGAGGTGG + Exonic
1014968884 6:127790857-127790879 TGCAAGGCTGTGGCTGGATGAGG + Intronic
1015100380 6:129471460-129471482 GGCAAGCCAGTGACTGGAGGTGG - Intronic
1016993010 6:149942552-149942574 AGCAGGCCTGTGGCTGGTGGGGG - Intronic
1018742495 6:166741260-166741282 TTCAAGCCAGTGGATGGCGTTGG + Intronic
1019273424 7:163462-163484 GGGAAGCCCGTGGCAGGCGTGGG + Intergenic
1019726988 7:2608210-2608232 TGGGGGCCCGTGGCGGGCGGAGG + Intronic
1020807386 7:12807518-12807540 TGCAAGCCTGTGGGAGGTGGAGG - Intergenic
1022959692 7:35414740-35414762 CACAAGCCCATGGCTGGAGGGGG - Intergenic
1026319855 7:69258978-69259000 TGCAAGCTCCTGGGTGGCGCTGG + Intergenic
1026454308 7:70557372-70557394 TCCCAGCCCTTGGCTGGCAGAGG + Intronic
1027374399 7:77536704-77536726 TCCCAGCCCACGGCTGGCGGCGG + Intergenic
1030149322 7:106387044-106387066 TGCAAGTCCCTGGCTGGCACTGG - Intergenic
1031096542 7:117427417-117427439 GGCCTGCCAGTGGCTGGCGGAGG - Exonic
1032894409 7:136234841-136234863 TGAAAGCCGGTGGCTGGGGTAGG + Intergenic
1035181132 7:157090470-157090492 TGCAGGGCCCTGGCTGGAGGAGG + Intergenic
1035970826 8:4246318-4246340 TGCAAGGACGTGGATGGAGGTGG - Intronic
1036294095 8:7521536-7521558 TGCAACCCCATGGCCGGCAGAGG + Intergenic
1036295882 8:7536948-7536970 TGCAAGCCCATAGCCGGCAGAGG + Intergenic
1036326684 8:7784071-7784093 TGCAAGCCCATAGCCGGCAGAGG - Intergenic
1036328467 8:7799455-7799477 TGCAACCCCATGGCCGGCAGAGG - Intergenic
1036788937 8:11704988-11705010 GGCAGCCCCGTGGCCGGCGGAGG - Intronic
1041167423 8:55103062-55103084 TGCAAGACGGTGGTCGGCGGTGG + Exonic
1044973645 8:97643879-97643901 TGCAAGGCGGGGGCGGGCGGGGG - Intergenic
1049419094 8:142509084-142509106 TGTGAGCCGCTGGCTGGCGGGGG - Intronic
1049570872 8:143369741-143369763 TGAAAGCCCGTGGCGGGCGTGGG - Intronic
1061162411 9:128902875-128902897 TGCCAGCCCAGGGCGGGCGGTGG + Intronic
1062069809 9:134549577-134549599 TGCCAGCCTGAGGCTGGGGGTGG + Intergenic
1062230327 9:135479000-135479022 TGTGTGCCCGAGGCTGGCGGTGG - Intergenic
1062506751 9:136881603-136881625 GGCAAGCCTGGGGCTGGCTGTGG - Intronic
1186427778 X:9477836-9477858 TGGTGGCCCGTGGCTGGAGGTGG - Intronic
1190596727 X:52059502-52059524 TGCAAGACCCTGGATGGCAGGGG + Intergenic
1190612097 X:52194571-52194593 TGCAAGACCCTGGATGGCAGGGG - Intergenic
1190692190 X:52921022-52921044 TGCGAGGCCGTGACTGGGGGGGG + Intergenic
1190929547 X:54935767-54935789 TGCAAGCCCCTGGATGGCAGGGG - Intronic
1194980505 X:100435389-100435411 TGCAAGCTCCTGGTTGGGGGTGG - Intergenic
1196670482 X:118361484-118361506 TGTAATCCCGAGGCAGGCGGGGG + Intronic