ID: 1004397382

View in Genome Browser
Species Human (GRCh38)
Location 6:15257515-15257537
Sequence TTGACTCATCTCTTCGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004397377_1004397382 5 Left 1004397377 6:15257487-15257509 CCGTTGGTTGATAGTTACCACTA No data
Right 1004397382 6:15257515-15257537 TTGACTCATCTCTTCGGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004397382 Original CRISPR TTGACTCATCTCTTCGGGAT GGG Intronic