ID: 1004399161

View in Genome Browser
Species Human (GRCh38)
Location 6:15272570-15272592
Sequence TTGTTTCCACAGCTGCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004399161_1004399167 -3 Left 1004399161 6:15272570-15272592 CCAAATTGCAGCTGTGGAAACAA 0: 1
1: 1
2: 4
3: 44
4: 341
Right 1004399167 6:15272590-15272612 CAAAGCAGGTAAAGGGGCCAGGG 0: 1
1: 0
2: 0
3: 23
4: 275
1004399161_1004399165 -9 Left 1004399161 6:15272570-15272592 CCAAATTGCAGCTGTGGAAACAA 0: 1
1: 1
2: 4
3: 44
4: 341
Right 1004399165 6:15272584-15272606 TGGAAACAAAGCAGGTAAAGGGG No data
1004399161_1004399168 1 Left 1004399161 6:15272570-15272592 CCAAATTGCAGCTGTGGAAACAA 0: 1
1: 1
2: 4
3: 44
4: 341
Right 1004399168 6:15272594-15272616 GCAGGTAAAGGGGCCAGGGTTGG No data
1004399161_1004399164 -10 Left 1004399161 6:15272570-15272592 CCAAATTGCAGCTGTGGAAACAA 0: 1
1: 1
2: 4
3: 44
4: 341
Right 1004399164 6:15272583-15272605 GTGGAAACAAAGCAGGTAAAGGG 0: 1
1: 0
2: 4
3: 32
4: 352
1004399161_1004399166 -4 Left 1004399161 6:15272570-15272592 CCAAATTGCAGCTGTGGAAACAA 0: 1
1: 1
2: 4
3: 44
4: 341
Right 1004399166 6:15272589-15272611 ACAAAGCAGGTAAAGGGGCCAGG 0: 1
1: 0
2: 2
3: 54
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004399161 Original CRISPR TTGTTTCCACAGCTGCAATT TGG (reversed) Intronic
901279482 1:8022496-8022518 TTGTTTCCTCATCTGCAAAATGG - Intronic
901491760 1:9600368-9600390 TGGTTTCCACAGCTGTAAATGGG + Intronic
902761407 1:18583244-18583266 TTGTTTCCACATCTGTAAAGTGG - Intergenic
902922667 1:19676258-19676280 CTGTTTCCACATCTGCAAAATGG - Intronic
903082241 1:20820142-20820164 TCGAATCCACAGCTGCAGTTTGG - Intronic
904177000 1:28637194-28637216 CAGTTTCCACATCTGTAATTAGG + Intronic
904803856 1:33117454-33117476 TTGTTACCACCTCTGCACTTTGG - Intronic
904927169 1:34058261-34058283 TTGTTTCCACACCTGCAAAATGG + Intronic
905864712 1:41370528-41370550 TTGTTTCCTCACCTGCAAAATGG - Intronic
906533722 1:46539607-46539629 TGGTTTACTCAGCTGCAATAGGG + Intergenic
906949119 1:50319889-50319911 TTGTTTCCTCATCTGAAAATTGG - Intergenic
907163964 1:52393543-52393565 TGGTTTTCGAAGCTGCAATTCGG + Exonic
907596695 1:55726895-55726917 TTGTTTCCAGAGCTCCAAGGAGG - Intergenic
907865883 1:58398673-58398695 TTGTTTCCTCATCTGCAACCTGG - Intronic
907980507 1:59475919-59475941 TTTTTTTCCCAGCTGCAATGGGG - Intronic
907995860 1:59631671-59631693 TTGTTTCCACAGTTTCAAACAGG - Intronic
909368352 1:74855711-74855733 TTGTTTCTCCAGCTGCAAAATGG - Intergenic
909500182 1:76326125-76326147 TTAGTTCCAAAGCTGCAAGTTGG + Intronic
909504388 1:76371713-76371735 TGGTTTCCAAAGCAGCAATGTGG + Intronic
910280260 1:85492364-85492386 CTGTTTCTAATGCTGCAATTTGG - Intronic
911061286 1:93750331-93750353 CTGTTTCCACATCTGCAAAATGG + Intronic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
911948517 1:104141007-104141029 ATGTGTTCACAGCTGCAAATTGG + Intergenic
912044574 1:105437860-105437882 TGGTTTCCACAGCTGGCACTAGG - Intergenic
913031606 1:114910310-114910332 TTCTTTCCACAGCTCCATTTGGG + Intronic
913409069 1:118531108-118531130 TTGTTCACAAATCTGCAATTTGG + Intergenic
913516118 1:119606940-119606962 TAGTTTGGAAAGCTGCAATTCGG - Intergenic
915274112 1:154776238-154776260 TTGTTTCCACATCTCCAACAGGG + Intronic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
919170825 1:193952032-193952054 TTGTTTCCACACCACAAATTTGG - Intergenic
919372284 1:196742888-196742910 ATTTTTCCACATCTCCAATTTGG + Intronic
920525751 1:206664647-206664669 CTGTTTCCATATCTGTAATTTGG + Intronic
921871986 1:220151271-220151293 TGGCTTCCACAGCTTCAATGAGG + Exonic
922371963 1:224920220-224920242 TTATTTCCACAGCTGGCATAGGG + Intronic
922994113 1:229942544-229942566 ATGTTTGCACAGCTGCAGTTTGG + Intergenic
923814718 1:237364241-237364263 TTGTTTACATAGCTCCATTTAGG + Intronic
1068142647 10:53026913-53026935 TCGCCTCCTCAGCTGCAATTAGG - Intergenic
1068706883 10:60086803-60086825 TTGGTTCCACAGTGACAATTGGG + Exonic
1070634870 10:78117183-78117205 TTGCTTGCAAATCTGCAATTTGG - Intergenic
1071131484 10:82398598-82398620 TTGTTTCCCCAGTTGAATTTAGG + Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1072154852 10:92715055-92715077 TTGCGTCCACAGCTGCAGTTTGG + Intergenic
1072601208 10:96931755-96931777 TTGTTTCAGCAGCAGCAGTTAGG + Intronic
1075219226 10:120569875-120569897 TTGTTTTCACACCCCCAATTAGG - Intronic
1075268062 10:121022749-121022771 TTGTTTCCAATGTTGCTATTTGG + Intergenic
1075559340 10:123457039-123457061 TAGTTTCCACATCTGCAAAGTGG - Intergenic
1076063607 10:127431241-127431263 TTGTTTCATCTGATGCAATTAGG - Intronic
1079505906 11:21151574-21151596 CAGTTTCCACATCTGAAATTTGG + Intronic
1081190012 11:40092329-40092351 TTCTTTCCACAAATGTAATTAGG - Intergenic
1082813994 11:57496280-57496302 TGGTTTCCTCATCTGCAAATTGG - Intronic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1086288486 11:85276823-85276845 TTATTTACACAGCTGTAATATGG - Intronic
1088227342 11:107635687-107635709 GTTTTTCCACATCTGCAATAAGG - Exonic
1088819664 11:113446591-113446613 CTGTTTCCACAGTGGCAATGAGG + Intronic
1088903476 11:114136323-114136345 CTGTTTCCACAGTTGCTTTTGGG - Intronic
1089490023 11:118877096-118877118 TGGTTTCCACATCTGCAGTGTGG + Intergenic
1089871645 11:121679126-121679148 TTCTTTCCTCTGCTTCAATTTGG + Intergenic
1090988649 11:131796163-131796185 TTGTTTCCCCAGCTGCAGGAGGG - Intronic
1093067906 12:14677936-14677958 ATGTTTGAACTGCTGCAATTAGG + Intronic
1093363013 12:18255413-18255435 TTGTTTACACGGCTGCATTTTGG - Intronic
1093615848 12:21223262-21223284 TTTTTTCCATAGGTGCATTTAGG - Intronic
1094294091 12:28884332-28884354 CTGTTTCCTCATCTGCAAATTGG - Intergenic
1094427185 12:30327964-30327986 TTGGATCCACAGCTGCAATTTGG - Intergenic
1096671504 12:53201183-53201205 TAGTTTCCACATCTGCAAAGTGG + Exonic
1097995618 12:65884808-65884830 TAGTTGCCTCAGCTGCAAATTGG + Intronic
1099322322 12:81165995-81166017 TAGTTTCTACAGCTGTAAATGGG - Intronic
1099906276 12:88775167-88775189 CAGTTTCCACATCTACAATTTGG + Intergenic
1100714621 12:97292873-97292895 TTGTTTCCTCATCTACAAATGGG - Intergenic
1100730023 12:97454740-97454762 TTGTTTCCCCTGCTGAAAGTGGG + Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1101845875 12:108362660-108362682 TTGTTTCCACATCTGTAAAATGG + Intergenic
1104070938 12:125344848-125344870 CTATTTCCACAGCTCCACTTTGG - Intronic
1104267639 12:127250961-127250983 TTGTTCCCACTTCTGCCATTTGG - Intergenic
1104335382 12:127889550-127889572 TTGTTGCCACAGCAACAAATGGG - Intergenic
1105265645 13:18811760-18811782 TTGTTTAAACAGCTGATATTTGG + Intergenic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1105531879 13:21228175-21228197 TTCTTTCCGCAGCTGCCATGGGG + Intergenic
1105845227 13:24288193-24288215 TTGTTTCCCCATCTGCAATGGGG - Intronic
1106004198 13:25753267-25753289 GTGGTTCCACAGCTGCCCTTTGG + Intronic
1106628508 13:31445246-31445268 TTGTTTCTCCAGCTGCAAAATGG + Intergenic
1106904762 13:34393440-34393462 TTGTTTTGACAGCTTGAATTTGG - Intergenic
1107883058 13:44850402-44850424 TTCTTTCCAGAGCTGAATTTGGG - Intergenic
1108735522 13:53279611-53279633 TTGTTTCCTCAGCTATAAATAGG + Intergenic
1108756551 13:53510053-53510075 TCGCTTCCACAGCAGCCATTAGG - Intergenic
1109121163 13:58459718-58459740 TTGTTTCCATATCTGTAATATGG + Intergenic
1109197217 13:59391376-59391398 CTGTTTCCACATCTGCAAAATGG + Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109670845 13:65604765-65604787 GTGTTATTACAGCTGCAATTAGG + Intergenic
1110008075 13:70297222-70297244 TGGGATCCACAGCTGCAGTTTGG - Intergenic
1110556092 13:76861082-76861104 TTGTTTTCATTGCTACAATTTGG - Intergenic
1112205278 13:97318126-97318148 TGGTTTCCACATCTGCAAAATGG + Intronic
1112414156 13:99190434-99190456 TTGTTCCTAAAGCAGCAATTAGG - Intergenic
1112938428 13:104829757-104829779 TTGTTTCCTCAGCAGCATATGGG + Intergenic
1113103784 13:106750400-106750422 TTTTATCCACAGGAGCAATTGGG + Intergenic
1114959279 14:27863953-27863975 TACTTTCCAGAGCTGAAATTTGG + Intergenic
1115183909 14:30662591-30662613 TTGTTTCAACAGATGTACTTTGG - Intronic
1118626868 14:67667448-67667470 CTGTTTCCTCATCTGCAAATAGG + Intronic
1121317982 14:92973638-92973660 TTGTTTCCAGAGCTGCTGTCAGG - Intronic
1121478723 14:94240607-94240629 TAGTTTCCACATGTGCAATGTGG + Intronic
1121744019 14:96273993-96274015 TTATTTCCAAAGCTTCACTTAGG + Intergenic
1122874674 14:104658475-104658497 TTGCTCCCAAATCTGCAATTTGG - Intergenic
1202832862 14_GL000009v2_random:56359-56381 TTGTTTAAACAGCTGAAATTTGG - Intergenic
1124937439 15:34186395-34186417 TGGGATCCACAGCTGCAGTTTGG - Intronic
1126594413 15:50371063-50371085 TTGTTTCCAAATTTGGAATTGGG + Intergenic
1127034284 15:54897686-54897708 ATGTTTTAACAGCTGCTATTTGG - Intergenic
1128118181 15:65125726-65125748 TTGTTTCCTCATCTGCAAAAAGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1128907904 15:71484699-71484721 CTGTTTCCACACCTGCAAATGGG - Intronic
1130635848 15:85619229-85619251 ATGTTCCCACAACTGCAATTGGG + Intronic
1131858239 15:96622640-96622662 TTGTTTCCTCATCTGCAAGCAGG - Intergenic
1132019137 15:98345429-98345451 ATGTTTCCATAGCTGGACTTTGG - Intergenic
1132472322 16:112364-112386 TAGTTTCCACATCTGCAAAATGG + Intronic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1134326268 16:13210739-13210761 TTGTTTCCCCATCTGCAAAACGG - Intronic
1134462425 16:14441194-14441216 TTGTTACCACAGCATCAAGTTGG + Intronic
1134587949 16:15428346-15428368 TTGTTTCTAGAGTTGAAATTTGG - Intronic
1136410649 16:30075248-30075270 TTGTTTCCCTAGCTGAAATGGGG + Intergenic
1137291650 16:47055657-47055679 TTGGATCCACAGCCGCAGTTTGG + Intergenic
1138139711 16:54557718-54557740 CTGTTTCCAAAGCTGAAATGAGG + Intergenic
1139158906 16:64479212-64479234 TTGTTTCCACATCTGTAAAATGG + Intergenic
1139192532 16:64881224-64881246 TTGTTTGCACAGCTGGAAAAGGG + Intergenic
1139222288 16:65195815-65195837 TTGTTTCCTCACCTGTAATTTGG + Intergenic
1140504074 16:75459380-75459402 TTGTTTGCATTGCTGCCATTTGG - Intronic
1141980395 16:87546754-87546776 TAGCTTTCACAGCTGCAATTGGG - Intergenic
1143109679 17:4546015-4546037 TTGATGCCACTGCTGCCATTTGG - Intronic
1143468452 17:7155022-7155044 TCTTTTCCAAAGCAGCAATTTGG - Intergenic
1144323500 17:14154770-14154792 TAGTTTCCTCAGCGGCAAATGGG - Intronic
1144802579 17:17940694-17940716 TGGTCTCCACAGCTGTCATTGGG + Intronic
1145241864 17:21244837-21244859 TTGTTTGCCCAGCAGCAGTTTGG - Intronic
1148643973 17:49208590-49208612 TAGTTTCCCCAGCTGCAAATGGG + Intronic
1148690816 17:49525815-49525837 TTGTTTCCTCAGCTGTAAAATGG + Intergenic
1149696910 17:58623262-58623284 TTGTTTCCTCATCTGTAAATTGG - Intronic
1150579624 17:66460521-66460543 CTGTCTGCACTGCTGCAATTCGG - Intronic
1150764936 17:67995107-67995129 GTGTTGCCAGAGCTGCAAATGGG - Intergenic
1153015992 18:583111-583133 GTGTTTCCTCATCTGCAAATAGG - Intergenic
1154422754 18:14249768-14249790 TTGTTTAAACAGCTGATATTTGG - Intergenic
1156149413 18:34224477-34224499 TTGTTTCCAGAGCTGGAAATAGG + Intronic
1157021984 18:43794270-43794292 TAGTTTCCACAGGTGCTACTTGG + Intergenic
1157155724 18:45263845-45263867 TTGATTCCACAGCTGTAGTAAGG - Intronic
1157306895 18:46524249-46524271 TTGTTTCCCCATCTGCAAAGGGG + Intronic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1160085835 18:75776987-75777009 TAGTTTCCTCATCTGCAAATTGG + Intergenic
1160358573 18:78249935-78249957 TTTTTTCCACTCCTGAAATTTGG + Intergenic
1161337010 19:3720100-3720122 CAGTTTCCACATCTGTAATTGGG - Intronic
1163323979 19:16591466-16591488 TTTTTTCCAAAGCTACAATTAGG - Intronic
1163469803 19:17489512-17489534 TAGTTTCCCCAGCTGCAAAATGG - Intronic
1163570092 19:18076138-18076160 TTGTTTCCCCACCTGCAATTTGG + Intronic
1163787137 19:19280528-19280550 TGGTGTCCACATCTGCAATGTGG - Intronic
1165027073 19:32969809-32969831 TCGGATCCACAGCTGCAGTTTGG + Intronic
1165759317 19:38311331-38311353 TGGTTTCCACACCTGTAAATTGG - Intronic
1165899961 19:39164767-39164789 CTGTTTCCACAGCTGCAAAATGG + Intronic
1166385908 19:42380867-42380889 TTGTTTTCTCATCTGCAAATGGG - Intergenic
1166765299 19:45249342-45249364 CTGTTTCCTCATCTGCAAATGGG + Intronic
1166808595 19:45501537-45501559 TTGTTTTCCCAGCTTGAATTGGG - Intronic
1168724327 19:58572521-58572543 TTGTTTCCCCATTTGCAAGTGGG + Intronic
1202639820 1_KI270706v1_random:71365-71387 TTGTTTAAACAGCTGACATTTGG + Intergenic
928215166 2:29355277-29355299 TTGTTTTCCCAGCTGAAAATAGG - Intronic
928704817 2:33937567-33937589 TGGTTTCCACAGCTGCATCTTGG + Intergenic
928881668 2:36103732-36103754 CTGTTTCCTCATCTGTAATTTGG + Intergenic
930970438 2:57388597-57388619 TGGTTTCCATAGATGCAGTTGGG - Intergenic
931070094 2:58637217-58637239 TTGTTTTCACAGTTGCAGATGGG + Intergenic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
931269548 2:60689424-60689446 AAGTTTCAACAGCTGCATTTTGG - Intergenic
931793030 2:65682352-65682374 TTGCCTGCAAAGCTGCAATTTGG + Intergenic
932145905 2:69316685-69316707 TTGTTTCCACTGGTGCAGTTGGG + Intergenic
940118899 2:150240611-150240633 TTGTTTCCAACTCTGCATTTTGG + Intergenic
941284292 2:163589980-163590002 TTGTTTCCTCATCTGTAATATGG - Intergenic
942184375 2:173410659-173410681 TTGTTTCCTCATCTGGAAATGGG - Intergenic
944680842 2:202075230-202075252 TTATTCCCAAAGCTGCAACTGGG - Intronic
944699464 2:202233676-202233698 TTGTTTATAAATCTGCAATTTGG - Intronic
1168874319 20:1160331-1160353 TTGCTTCCATGGCTGCACTTGGG + Intronic
1169712415 20:8579899-8579921 TTGTTTCCACAGGAACAAATAGG + Intronic
1171886485 20:30655719-30655741 TTGTTTAAACAGCTGACATTTGG + Intergenic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1173725212 20:45292765-45292787 TTGTTTCCTCATCTGCAAAGTGG - Intergenic
1174548554 20:51344625-51344647 TTGTTCCCACAGCCCTAATTAGG + Intergenic
1175463989 20:59177274-59177296 TTGTTTCCTCATCTGCAAAATGG - Intergenic
1176648150 21:9368965-9368987 TTGTTTAAACAGCTGACATTTGG + Intergenic
1176850712 21:13910191-13910213 TTGTTTAAACAGCTGATATTTGG + Intergenic
1178032678 21:28545727-28545749 TTCTTTCCTCTGCTCCAATTTGG - Intergenic
1179032341 21:37731589-37731611 AAGGTTACACAGCTGCAATTGGG + Intronic
1179295173 21:40055184-40055206 CTGTTTCCCCAGCAGCACTTTGG - Intronic
1179437574 21:41373024-41373046 CTGTCTCCCCAGCTGCAATAAGG - Intronic
1181646725 22:24235376-24235398 TGGTTTCCCCATCTGCAACTGGG - Intronic
1181784907 22:25220042-25220064 TTTCCTCCACATCTGCAATTAGG + Intronic
1182055480 22:27350623-27350645 TTCTTTCTACAAGTGCAATTAGG + Intergenic
1183139585 22:35924087-35924109 TGGTTTCCTCACCTGCAAATGGG + Intronic
1183195419 22:36350679-36350701 TTGTTTCCTCATCTGTAAATTGG - Intronic
1183198266 22:36368301-36368323 TTGTTTCCCCATCTGCAAAACGG - Intronic
1184441953 22:44522605-44522627 CTGTTTCCACATCTGCAAAATGG + Intergenic
1184871683 22:47244770-47244792 TTGTCTCAAGAGCTGCTATTTGG + Intergenic
1184916158 22:47570424-47570446 TTGTTTCCTCATCTGCAAAATGG - Intergenic
1185108694 22:48888713-48888735 TTGTTTCCACAGCTGCAATCAGG - Intergenic
1185255945 22:49831606-49831628 TTGTTCACACATCTGCTATTTGG + Intergenic
949508472 3:4748104-4748126 CAGTTTCCTCATCTGCAATTGGG - Intronic
950107088 3:10395052-10395074 CAGTTTCCCCAGCTGCAAATTGG + Intronic
950127155 3:10516798-10516820 TTGTTTCCTCATCTGCAAAATGG + Intronic
950154655 3:10712534-10712556 TTGTTTCCTCAACTGCAAAATGG - Intergenic
950568776 3:13787409-13787431 TTGTTTCCACTGCTGCAAAATGG - Intergenic
952269511 3:31817623-31817645 TTGGATCCACAGCCGCAGTTTGG + Intronic
952744186 3:36762498-36762520 TTGTTTCCAGAGATCCAATGTGG - Intergenic
954676592 3:52319140-52319162 TAGTTTCCTCAGCTGTAAATTGG + Intronic
955425825 3:58788768-58788790 TTGTTTCCACATCTGGAATATGG + Intronic
955685637 3:61545846-61545868 TTCTTTCCACATTAGCAATTTGG - Intergenic
956070429 3:65444215-65444237 TTGTATCAACATCTGCAAATTGG - Intronic
956328850 3:68082533-68082555 TTGTTTCCACAACTGTAAAATGG + Intronic
957185517 3:76936662-76936684 ATGTTTCCAGATATGCAATTGGG + Intronic
957437192 3:80193777-80193799 CTTTTTCCACATCAGCAATTGGG - Intergenic
957445670 3:80310703-80310725 TCGCTTCCTGAGCTGCAATTGGG + Intergenic
957705036 3:83770065-83770087 TGGGATCCACAGCTGCAGTTTGG - Intergenic
958745472 3:98128674-98128696 TTGTTTCAACACCTGAATTTTGG + Intergenic
958748281 3:98164013-98164035 TTGTTTCAACACCTGAATTTTGG + Intergenic
958752067 3:98203355-98203377 TTGTTTCAACACCTGAATTTTGG + Intergenic
959632304 3:108520966-108520988 TTGTTTCCACATCTGTAAAATGG - Intronic
959870679 3:111323896-111323918 CTGTTTCCACACCTGCAAAATGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960136858 3:114114222-114114244 CTGGCACCACAGCTGCAATTAGG - Intergenic
960380402 3:116953609-116953631 TTGTTTCCTCATCTGAAATAGGG + Intronic
960399515 3:117179246-117179268 CTGTTTCCACAGCTGCAGAATGG + Intergenic
962875244 3:139531017-139531039 TTGTTCACAAATCTGCAATTTGG - Intronic
964223457 3:154370821-154370843 TTGCCTCCTCAGCTGCCATTAGG + Intronic
964791950 3:160460731-160460753 TCGGATCCACAGCTGCAGTTTGG + Intronic
965787395 3:172350262-172350284 TTGTTTCCTCAGCTGTAAAATGG - Intronic
967557201 3:190874522-190874544 TTGCTTCCAAATCTGCAGTTTGG + Intronic
968116203 3:196091935-196091957 TAGTTTCCACACCTGAAAATGGG - Intergenic
968300204 3:197607119-197607141 TTGTTTCTAAAGCTGCAACTTGG + Intergenic
1202738736 3_GL000221v1_random:36022-36044 TTGTTTAAACAGCTGACATTTGG - Intergenic
969405996 4:6992156-6992178 TTCTTTCCACATCTGCAAAATGG - Intronic
971361691 4:25943915-25943937 TGGTTTCCACATCTGTAAATAGG + Intergenic
973370062 4:49237718-49237740 TTGTTTAAACAGCTGACATTTGG + Intergenic
973390963 4:49557692-49557714 TTGTTTAAACAGCTGACATTTGG - Intergenic
973903583 4:55503945-55503967 TAGTTTCCACAGTTTCTATTTGG + Intronic
974489916 4:62551499-62551521 TTGTTTCCACAGTTGCATAAAGG - Intergenic
974501853 4:62715063-62715085 TTGTTTCCTCATTTTCAATTTGG + Intergenic
974655633 4:64816676-64816698 AGATTTCCATAGCTGCAATTAGG + Intergenic
975000731 4:69221634-69221656 TCGTCTCCTCAGCTGCAATTGGG - Intergenic
975004724 4:69270635-69270657 TTGCCTCCTCAGCTGCAGTTGGG + Intergenic
975013144 4:69379615-69379637 TTGCCTCCTCAGCTGCAGTTGGG + Intronic
975724560 4:77279301-77279323 TTGTTGCCAAATCTGCAACTTGG + Intronic
977684531 4:99833459-99833481 TTCCTTCCACAGGTGCACTTAGG + Intronic
978482822 4:109213690-109213712 TTGTTTACAAACCTGCAATTTGG - Intronic
978759602 4:112342347-112342369 TCATTTCCACTCCTGCAATTAGG + Intronic
980227138 4:130000699-130000721 TTTTTTCTTCAGCTGCATTTGGG - Intergenic
980475570 4:133310125-133310147 GGGGTTCCACAGCAGCAATTGGG + Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982014597 4:151140922-151140944 TTGTTTCTGCAGGTGCATTTTGG - Intronic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
983554116 4:169044872-169044894 TTGCTTCCAAATCTGCAATTTGG + Intergenic
985319434 4:188693193-188693215 ATGTTTCCAGACTTGCAATTTGG - Intergenic
1202767176 4_GL000008v2_random:157220-157242 TTGTTTAAACAGCTGACATTTGG + Intergenic
985569675 5:638211-638233 TTGTCTCCAAAGCTGGAATCGGG + Intronic
986230802 5:5863434-5863456 TTGTTTCCACAACTGAAAGATGG - Intergenic
987204491 5:15610878-15610900 TTGTTTCTTCAGCTGTAAATGGG - Intronic
988255664 5:28817413-28817435 TTGTCTCCACATGTGCAATAAGG - Intergenic
990265677 5:54072350-54072372 GTTTATCCACAGCTGCAATTAGG - Intronic
990302899 5:54466462-54466484 TGTTTTCCACAGCTGAACTTTGG + Intergenic
990903874 5:60781841-60781863 TAGTTTCCTCATCTGCAAATTGG + Intronic
992767812 5:80018164-80018186 GTTTTTCCAGAGCTCCAATTAGG + Intronic
994790947 5:104224470-104224492 TTGGATCCATAGCTGCAGTTTGG + Intergenic
995205452 5:109474898-109474920 TTGCTTACAAATCTGCAATTTGG + Intergenic
995719014 5:115110167-115110189 TTGTTTCCTCAGCTGTAAATGGG - Intergenic
995894794 5:117000319-117000341 TTGTTTCTACATCTTCAATCTGG - Intergenic
996440362 5:123483249-123483271 TAGTTTTCACAGTTGAAATTTGG + Intergenic
998942590 5:147300789-147300811 TAGTTTCCTCACCTGTAATTAGG + Intronic
999407414 5:151319053-151319075 TTGTTTCCTCAGCTGCAAAATGG + Intronic
999480851 5:151947044-151947066 TTATTTCCAAACTTGCAATTTGG - Intergenic
1000110108 5:158100026-158100048 TTGTTCCGACAGCTCCAACTCGG + Intergenic
1000982866 5:167835307-167835329 TTGAATGCAGAGCTGCAATTTGG + Intronic
1001115087 5:168932718-168932740 TTGTTTCCACATCTGTAAAACGG + Intronic
1001422961 5:171600962-171600984 TTCTTTCCACAGATTCTATTTGG + Intergenic
1001713591 5:173797024-173797046 TTGTCTGCATTGCTGCAATTTGG + Intergenic
1001800905 5:174543192-174543214 TTGTTTCCTCACCTGCAAAACGG + Intergenic
1002453336 5:179331667-179331689 TTGTCTCTGCAGCTGCATTTAGG + Intronic
1002532273 5:179854652-179854674 TTTTTTTTACAGCTTCAATTTGG - Intronic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1003779631 6:9409472-9409494 ATCTTTCAACATCTGCAATTAGG + Intergenic
1003801819 6:9678630-9678652 TGTTTTCCACAGGAGCAATTGGG + Intronic
1003989772 6:11474171-11474193 TTGATACCACATCTGCAACTAGG - Intergenic
1004399161 6:15272570-15272592 TTGTTTCCACAGCTGCAATTTGG - Intronic
1005265045 6:24102963-24102985 TTGTTTCAACAGATCCAGTTTGG + Intergenic
1005718233 6:28573816-28573838 TTGTTTCGCCATCTGAAATTAGG + Exonic
1007193426 6:40039146-40039168 GTCTTTCCCCAGCTGCAAATGGG - Intergenic
1007290086 6:40779056-40779078 TTGTTAGCACAGTTGCACTTGGG - Intergenic
1007649603 6:43410690-43410712 TTGTTTCCATCTCTGTAATTTGG - Intergenic
1008119891 6:47600847-47600869 TTGTTTCCAGAGTTAAAATTGGG - Intronic
1008372709 6:50752905-50752927 TTATTTCCTCAGCTTCAAATGGG + Intronic
1008691718 6:53986765-53986787 CTGTTTCCTCAGCTGAAAATGGG - Intronic
1009486505 6:64230261-64230283 TTGTTTCCACAGAGACAATTAGG - Intronic
1009519825 6:64667390-64667412 TTGTGTCCAAAGCTGCAAGGAGG - Intronic
1011457935 6:87572189-87572211 TAGTTTTCACAGCTGAAATACGG + Intronic
1011615853 6:89197955-89197977 TTGGTTTCACAACAGCAATTTGG - Intronic
1012077557 6:94710823-94710845 ATGTTTTCACAGCTGCAAGCAGG - Intergenic
1012551194 6:100465809-100465831 TTGTTTAAACAGCTCCTATTAGG - Intergenic
1013297250 6:108768746-108768768 TCATTTCCTCAGCTGCAAATGGG - Intergenic
1013752810 6:113426671-113426693 TAGTTTCCACATCTGCAAAATGG - Intergenic
1013795879 6:113888401-113888423 TTGTTTCCAAAGCTGGTATCTGG + Intergenic
1014228671 6:118877266-118877288 TTGTTTACAGATCTGCAATTTGG - Intronic
1014546046 6:122736847-122736869 TTGTTTCCAAAACTGGAATGAGG + Intergenic
1015455785 6:133424791-133424813 TTGGATCCACAGCCGCAGTTTGG + Intronic
1015670660 6:135686262-135686284 TCATTTCCACATCTGTAATTGGG + Intergenic
1017721360 6:157245607-157245629 TTGCTTCCACAGCTGCAGCGGGG - Intergenic
1018132787 6:160748507-160748529 TTGTTTCCTCAGCTGAAATGTGG + Intronic
1018296755 6:162355575-162355597 TTGCTACTACAGCTGCAGTTAGG - Intronic
1018511707 6:164531488-164531510 TTTTTTTAACACCTGCAATTCGG + Intergenic
1018518524 6:164616475-164616497 TTGAATCCACAGGTGCATTTGGG + Intergenic
1019476095 7:1245077-1245099 TTGTTTCCAGTGCTGCAGTCGGG + Intergenic
1020568878 7:9831618-9831640 TTATGTGCACAGCTGCTATTTGG - Intergenic
1020698742 7:11449723-11449745 TTCTTTCTACACCTGCCATTTGG + Intronic
1023338384 7:39193586-39193608 TAGTTTCCACATCTGCAAAATGG + Intronic
1023789002 7:43737317-43737339 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1024254662 7:47531820-47531842 TTGGATCTACAGCTGCAGTTTGG - Intronic
1024282668 7:47732401-47732423 TTGTTTCCTCATCTGCAACCTGG - Intronic
1024323449 7:48090718-48090740 TTGTTTGCCCATCTGCATTTTGG + Intronic
1024633550 7:51268599-51268621 TTATTTCCACATCTGCAAAAGGG - Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1027752300 7:82164952-82164974 CTCTTTTGACAGCTGCAATTCGG + Intronic
1028994256 7:97082867-97082889 GTATTTCCACACCTTCAATTGGG - Intergenic
1031610023 7:123814820-123814842 TTTTTCCCACAGCCACAATTTGG - Intergenic
1032166036 7:129545698-129545720 TTTTCTCCTCACCTGCAATTAGG + Intergenic
1032785508 7:135196744-135196766 TAGTTTCCACAGCTGTAAAATGG - Intronic
1033658638 7:143389345-143389367 CTGTTCCCACAGCTGCACTGAGG - Intronic
1033801086 7:144903116-144903138 TTGTTTCTACAACAGCACTTAGG + Intergenic
1034756875 7:153630584-153630606 TAGTTTCCTCAGCTGTAAATTGG - Intergenic
1035450850 7:158976086-158976108 TCATATCCACAGCTGCAGTTTGG - Intergenic
1035943546 8:3931927-3931949 TAGATTCTACAGCTACAATTGGG - Intronic
1037653471 8:20862206-20862228 TTGTTACCACTGTTGAAATTTGG + Intergenic
1038920606 8:32079443-32079465 TAGTTTCCACATCTGTAAGTTGG - Intronic
1039977118 8:42376579-42376601 TTATTTCCTCATCTGGAATTAGG + Intronic
1040436002 8:47392174-47392196 TTGTTTCCCCATCTTCAAATTGG - Intronic
1041817306 8:61988791-61988813 TTGTTTCAACACTTGCATTTTGG - Intergenic
1042938587 8:74085201-74085223 TTGTTTCCACATCTGTAAAATGG - Intergenic
1044269650 8:90226703-90226725 TGGTTTCCTCAGCTGCAAAGGGG + Intergenic
1045862109 8:106825331-106825353 TTTTTTCCCCAGCTGAATTTAGG - Intergenic
1047483467 8:125306847-125306869 TTGTTTCCACATCTGTAAGATGG + Intronic
1047504145 8:125465550-125465572 TTGTTTCCTCCTCTGCAATACGG - Intergenic
1047953991 8:129959342-129959364 TTGTTTCCTCATCTGCAAACTGG + Intronic
1048181279 8:132196848-132196870 TTGTTTCCTCATCTGTAAATAGG + Intronic
1048896454 8:138996847-138996869 TTGTTTCCTCATCTGTAATGTGG - Intergenic
1051074400 9:13213431-13213453 TTGTTTTGACAGCAGCTATTAGG - Intronic
1051098030 9:13489032-13489054 TTGCTTCCATAGCAGCCATTAGG - Intergenic
1051106221 9:13583737-13583759 TTTTTTCCACAGCTTTATTTAGG + Intergenic
1051563522 9:18470184-18470206 TGGTTTCCTCATCTGCAAATTGG + Intergenic
1051934709 9:22433087-22433109 TTATTTGTACAGCTGCAAATTGG - Intergenic
1053076481 9:35138793-35138815 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1053200800 9:36150443-36150465 ATGTTTCAAGAGCTGCAAATGGG + Intronic
1053390300 9:37730074-37730096 TTGTCTCCACATCTGCAAAATGG - Intronic
1053512896 9:38704162-38704184 CTGTTTCCTCAACTGCAAATGGG + Intergenic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054338480 9:63830951-63830973 TTGTTTTCACAACTGGAATACGG - Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1055419857 9:76127852-76127874 CTGTTTCCTCAGCCGCAATGTGG - Intronic
1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG + Intergenic
1057323860 9:94041649-94041671 TTGTTTCCACTTTTGCCATTGGG + Intronic
1058554379 9:106151219-106151241 TGGTTTCCCCATCTGCAAATTGG - Intergenic
1059733687 9:117081076-117081098 TTTCTTCCACAGCTCCCATTGGG - Intronic
1060031748 9:120220294-120220316 TTGTTTCCTCATCTGTAATATGG - Intergenic
1060880436 9:127114297-127114319 TAGTTTCCTCAACTGCAAATAGG - Intronic
1061584595 9:131557764-131557786 TTGTTTCCATATCTGCAAAGTGG + Intergenic
1061696597 9:132380415-132380437 TTGTTTCCTCATCTGCATTATGG - Intronic
1203707466 Un_KI270742v1:66466-66488 TTGTTTAAACAGCTGACATTTGG - Intergenic
1203547928 Un_KI270743v1:142097-142119 TTGTTTAAACAGCTGACATTTGG + Intergenic
1186274708 X:7927109-7927131 TTGATTCCACTTCTGCAAATGGG + Intronic
1186282829 X:8012566-8012588 TTGTTTCCACATATGTAAATAGG + Intergenic
1186799576 X:13079378-13079400 TTGTTTTCACAGCTGCCTTCTGG + Intergenic
1187651153 X:21408437-21408459 TTGTTTGCACAGCTGCTTTCAGG + Intronic
1188451647 X:30313491-30313513 GTTTGTCCACAACTGCAATTTGG + Intergenic
1188466597 X:30488651-30488673 TTGTTCTCACATCTGCAGTTTGG + Intergenic
1188650642 X:32627537-32627559 TTGTTTCCCCACCTGTAAATTGG - Intronic
1189172861 X:38926218-38926240 TTGCCTCCACAGCTCCACTTTGG + Intergenic
1189360061 X:40343483-40343505 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1190534480 X:51412067-51412089 CAGTTTCCACACCTGCAAATTGG + Intergenic
1190786337 X:53653338-53653360 TGGTTTCCACAGCTGCAAAATGG - Intronic
1191221107 X:57989495-57989517 TTGGATCTACAGCTGCAAATGGG - Intergenic
1194205188 X:91003177-91003199 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1194303405 X:92214471-92214493 TTGTTTCCACATCTGTAACTTGG + Intronic
1197048092 X:122024841-122024863 TTGTTTCTAAAGCTAAAATTTGG - Intergenic
1197524377 X:127544585-127544607 TTGTTTCCAGAGATGCTATCCGG + Intergenic
1197613553 X:128666090-128666112 TATTTTCCACAGCCACAATTGGG - Intergenic
1197996416 X:132380379-132380401 TTGTTTCCAGAGGTGTCATTTGG - Intronic
1198699582 X:139382600-139382622 TCGGATCCACAGCTGCATTTTGG + Intergenic
1198777576 X:140197164-140197186 TGGTTACCCCATCTGCAATTTGG + Intergenic
1199271920 X:145894007-145894029 TTGTTTCCTTTGCTGCAATGTGG - Intergenic
1199999912 X:153054955-153054977 CTGTTTCCACCCCTGCAAGTTGG + Intergenic
1200551007 Y:4578298-4578320 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1201438349 Y:13984451-13984473 TTGTCTCCACAGTTGCAAAAAGG + Intergenic
1201981635 Y:19915787-19915809 TTGCCTCCTCAGCTGCAATTAGG - Intergenic