ID: 1004399218

View in Genome Browser
Species Human (GRCh38)
Location 6:15273060-15273082
Sequence CAGTTAGGGGATTCAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004399213_1004399218 5 Left 1004399213 6:15273032-15273054 CCTAGTAAGTTGCCATCTATAGA 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG 0: 1
1: 0
2: 0
3: 4
4: 109
1004399214_1004399218 -7 Left 1004399214 6:15273044-15273066 CCATCTATAGAGAAAGCAGTTAG 0: 1
1: 0
2: 1
3: 19
4: 169
Right 1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG 0: 1
1: 0
2: 0
3: 4
4: 109
1004399212_1004399218 19 Left 1004399212 6:15273018-15273040 CCTACAAAATAAAGCCTAGTAAG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG 0: 1
1: 0
2: 0
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004399218 Original CRISPR CAGTTAGGGGATTCAGCATA TGG Intronic
901025984 1:6278996-6279018 CAGGTGGGGGATTCAGCATCAGG + Intronic
905164617 1:36071914-36071936 CAGTGATAGGATTCAGCATTTGG - Exonic
911633756 1:100211366-100211388 CAGTTAGGGAAATCTGAATATGG - Intronic
912594885 1:110864749-110864771 CAGGAAGAGGATTCAGAATATGG + Intergenic
915047746 1:153032651-153032673 GGGATAGGGGATTCAGCATCTGG - Exonic
918068539 1:181118313-181118335 AAGTCATGGGATTCAGCAAAAGG - Intergenic
918508552 1:185284706-185284728 GAGTTAGGGTGTCCAGCATATGG + Intronic
918524383 1:185449915-185449937 TTGTTGGAGGATTCAGCATAAGG - Intergenic
918955986 1:191208197-191208219 CAGTCAGTGGATCCAGGATATGG + Intergenic
921552836 1:216559389-216559411 GAGTTATGGGATGCAGCAGAGGG + Intronic
921639772 1:217538905-217538927 CAGTGATGGGAGTCAGCACAAGG - Intronic
1065991726 10:31016924-31016946 CAGTTACTGGATTTAGCTTAAGG + Intronic
1070520491 10:77248893-77248915 CAATCAGTGGATTCAGCACAAGG - Intronic
1074071347 10:110072968-110072990 CAGTTGTGGGATTCAGCTGAGGG - Intronic
1078944165 11:16045237-16045259 CAGATTGGGGATTCAAGATAAGG - Intronic
1078945189 11:16058503-16058525 GATTTATGGGCTTCAGCATAAGG + Intronic
1080349632 11:31368998-31369020 CAGTTAGGGGGCACTGCATATGG - Intronic
1082648334 11:55755858-55755880 AGATCAGGGGATTCAGCATAGGG - Intergenic
1083998637 11:66284282-66284304 CAGGCTGGGGATTCAGCTTAGGG - Intronic
1086736488 11:90312361-90312383 CAGTTAGGAGAGTCAGGAGATGG + Intergenic
1088708388 11:112483946-112483968 AAGTCAGGGGCTCCAGCATAGGG + Intergenic
1091896124 12:4106520-4106542 CAGATACGGCATTCAGCATCTGG + Intergenic
1093489515 12:19688831-19688853 CAGTGAGGGAGTTCACCATATGG - Intronic
1095487866 12:42703264-42703286 GAGTGAGAGGATTCATCATAGGG + Intergenic
1097639741 12:62165838-62165860 AAGTTAGGGGACCCAGCTTAGGG + Intronic
1098362375 12:69667238-69667260 AATTGAGGGGATTCAGCAGAGGG - Intronic
1100856033 12:98758043-98758065 CAGTTAGGGGGTACTGCGTATGG - Intronic
1107791929 13:44011392-44011414 CATTTTGGGGATTCAGCTTAGGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1111947179 13:94678092-94678114 CAGTGAGGGGAATCAGGAGAAGG + Intergenic
1114305776 14:21421736-21421758 GGGTTAGGGGCTTCAACATATGG - Intronic
1114345565 14:21790871-21790893 CACATAGGGGATTAAACATATGG - Intergenic
1128088863 15:64905482-64905504 CAGTTGGGAGACTCAGCATGTGG + Intronic
1130372013 15:83293053-83293075 CAGTTATGGAATTCAACTTAAGG - Intergenic
1131441465 15:92462802-92462824 CTTTTAAGGGATTCAGCCTAGGG + Intronic
1131978439 15:97970645-97970667 CAGTTAGGGGGTTGAGGGTAAGG - Exonic
1133187293 16:4109113-4109135 CAGGAAGGGGATACAGCAGATGG - Intronic
1134856083 16:17520540-17520562 CAGTTAGGGGATGAAGGTTATGG + Intergenic
1138880642 16:61010113-61010135 CAGTTTGAAGATTCAGCATTTGG - Intergenic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1149542370 17:57477315-57477337 CTGTTAATGGATTCAGCATCTGG + Intronic
1149652127 17:58282009-58282031 CAGTTAGGTGATGCAGCCCAGGG + Intergenic
1158497048 18:57965737-57965759 CAGACATGGGATTCAGCAAATGG + Intergenic
925086417 2:1111365-1111387 CAGGAAGGGGAGTCAGCGTACGG + Intronic
926421338 2:12702683-12702705 CAGTGAGTGGAGTCACCATATGG - Intergenic
929549711 2:42881691-42881713 CATTTTGGGGATCCAGCTTAGGG + Intergenic
931172436 2:59817893-59817915 CAGTTAGTGAATTCAGCAAAGGG + Intergenic
933303741 2:80571795-80571817 GAGTTGGAGGATTCAGAATAGGG + Intronic
934474664 2:94586421-94586443 CAGTTTGGGGTTTCAGCAGGTGG - Intergenic
939374498 2:141346314-141346336 CAGTTCTGGGATTCATTATAGGG + Intronic
1170507312 20:17040751-17040773 TCGTTAGAGTATTCAGCATACGG - Intergenic
1170762411 20:19262575-19262597 CAATTGGGGGAATCAGCATATGG - Intronic
1177549547 21:22601932-22601954 CAGATAGGGGAACCTGCATAGGG - Intergenic
1181951117 22:26554489-26554511 GAGGTAGGGGACTGAGCATAGGG + Intronic
1182621971 22:31623381-31623403 CAGTCTGGGGATTCAGAAAATGG - Intronic
954789316 3:53119495-53119517 CAGGTAAAGCATTCAGCATAGGG + Intronic
961219398 3:125187767-125187789 CAGGCAGGGGAATCAGCATGAGG - Intronic
966531671 3:180988568-180988590 AAGTTACAGGATTCATCATATGG + Intronic
969946130 4:10784878-10784900 CAGTTAGTTGACTCAGCATTTGG - Intergenic
973089607 4:46118171-46118193 CTGTTAGGGGGTTGAGGATAAGG - Intronic
973287203 4:48431887-48431909 CAGGTAAGGGATTCGACATATGG - Intergenic
977166035 4:93698927-93698949 AAGTTAGGGAATTAAGCCTAAGG - Intronic
977761789 4:100746378-100746400 CAGTGAGGGTATCCAGCACATGG - Intronic
979010491 4:115362013-115362035 CAGTTAAAGTTTTCAGCATAAGG + Intergenic
983663036 4:170150787-170150809 AACTTATGGGATTCAGCAAAAGG - Intergenic
986006769 5:3674661-3674683 CAGTCAGTGGATTCAGGAGAGGG + Intergenic
986055275 5:4130409-4130431 AAGTTAGGGTCTTCAGGATACGG - Intergenic
986079790 5:4378446-4378468 CAGTTAAGGGATGCAGCCGAAGG + Intergenic
986132037 5:4940986-4941008 CAGTTCGGGGGTGCTGCATATGG + Intergenic
989268248 5:39502621-39502643 GATTTAGGGCCTTCAGCATAGGG - Intergenic
991051344 5:62275616-62275638 GAGTTAAGGGATTCAAGATAGGG - Intergenic
992381937 5:76246132-76246154 GAGTTAGGGGAATCACCATGTGG + Intronic
1003808826 6:9756961-9756983 CAGTTGGCGGTCTCAGCATATGG - Intronic
1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG + Intronic
1005123785 6:22421748-22421770 CAGTTTGGGTATTTTGCATATGG + Intergenic
1006210502 6:32389605-32389627 CACTTAGGACATTCAGCATGAGG + Intergenic
1008733255 6:54509241-54509263 GAGCTAGGGGATTCAGGAAATGG + Intergenic
1009522516 6:64701164-64701186 CAGTTATGTTATTCGGCATATGG - Intronic
1009855568 6:69258479-69258501 CAGTTAATGCATTCAGCAAAGGG + Intronic
1012496838 6:99843063-99843085 AAGTTAGTGAATTCAGCTTACGG - Intergenic
1013943089 6:115689683-115689705 TATTTAGGGGATACAGGATAGGG - Intergenic
1014327335 6:120015616-120015638 AACTTATGGGATTCAGCAAAAGG + Intergenic
1018474402 6:164125309-164125331 CAGGTTGTGGATTCCGCATAAGG - Intergenic
1019767115 7:2859757-2859779 GAGATAGGGGTTTCATCATATGG + Intergenic
1019829606 7:3314110-3314132 CATACAGGGGATTCAGCATCTGG + Intronic
1021679148 7:23112172-23112194 ATGTTGAGGGATTCAGCATAAGG + Intronic
1025591610 7:62867051-62867073 CAGTCTGGGGATTCAGCAGTTGG + Intergenic
1042813944 8:72857342-72857364 CAGGTAGAGGAATGAGCATATGG + Intronic
1045964163 8:108004253-108004275 CTGTTTGGGCATTCAGCAAAAGG + Intronic
1048085514 8:131173758-131173780 CACTTAGTGGATACAGTATAGGG + Intergenic
1049059393 8:140264406-140264428 CATTTAGTAGAGTCAGCATAAGG - Intronic
1052855385 9:33403337-33403359 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1053548311 9:39046993-39047015 CAGTCATGGAATTCAGCATTGGG + Intergenic
1053683399 9:40499680-40499702 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1053812431 9:41867047-41867069 CAGTCATGGAATTCAGCATTGGG + Intergenic
1053933380 9:43127995-43128017 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1054280315 9:63125248-63125270 CAGTTTGGGGTTTCAGCAGGTGG - Intergenic
1054296503 9:63335178-63335200 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1054394520 9:64639683-64639705 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1054429169 9:65144882-65144904 CAGTTTGGGGTTTCAGCAGGTGG + Intergenic
1054501214 9:65876653-65876675 CAGTTTGGGGTTTCAGCAGGTGG - Intergenic
1054618164 9:67320392-67320414 CAGTCATGGAATTCAGCATTGGG - Intergenic
1055732143 9:79289146-79289168 CAGTGAGAGGCTTCTGCATAGGG + Intergenic
1057407151 9:94783075-94783097 CAGTTAGCTGATCCAGCTTAAGG + Intronic
1058320041 9:103617879-103617901 CAGCTCTGGGATTCAGCAGAAGG - Intergenic
1185831304 X:3305472-3305494 CAGTTCTGGGAGTCAGAATATGG + Intergenic
1189852619 X:45192485-45192507 CAGTTTGGGGAATCAGTGTAGGG - Intronic
1192602079 X:72475522-72475544 CTGCCAGGGGATGCAGCATATGG + Intronic
1194805021 X:98316519-98316541 CAGTTTGGGGATTCAGAGTTGGG + Intergenic
1194876638 X:99197702-99197724 AACTTATGGGATTCAGCAAAAGG - Intergenic
1199196979 X:145042803-145042825 CAGACATGGGATTCAGAATATGG + Intergenic
1200478347 Y:3669876-3669898 TAGTTAGGTGATACAGAATATGG + Intergenic
1201640178 Y:16169701-16169723 CAGTCAGGTGATTCAGCAACAGG - Intergenic
1201662636 Y:16415624-16415646 CAGTCAGGTGATTCAGCAACAGG + Intergenic