ID: 1004401692

View in Genome Browser
Species Human (GRCh38)
Location 6:15294566-15294588
Sequence GTGAGGAGGAGTGAAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004401687_1004401692 -6 Left 1004401687 6:15294549-15294571 CCTGCTTACCCTAGCAAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG 0: 1
1: 0
2: 3
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004401692 Original CRISPR GTGAGGAGGAGTGAAAGTGC AGG Intronic
900033999 1:391919-391941 CTGAGGAGGTGGGAATGTGCTGG + Intergenic
900054835 1:621809-621831 CTGAGGAGGTGGGAATGTGCTGG + Intergenic
900308984 1:2024462-2024484 GTGAGGAGGAGGCAAGGGGCAGG - Intronic
900430737 1:2602002-2602024 GTGGGTAGGAGTGGAATTGCTGG - Intronic
900500064 1:2999969-2999991 GCGAGGAGGAGGGGATGTGCTGG + Intergenic
901419303 1:9139657-9139679 GTGAGGAGGAGAGATCATGCAGG + Intergenic
901880538 1:12191373-12191395 GCGGGGAGGAGCGAAACTGCTGG + Intronic
902722709 1:18314824-18314846 GGGAGGAGGAGGGGAAGAGCTGG + Intronic
903230915 1:21921878-21921900 GTGGGAAGGAGTGTGAGTGCAGG - Intronic
903530591 1:24027292-24027314 GTGAGGAAGAGTCAAAGTTTAGG - Intergenic
905006132 1:34711988-34712010 GTAAACAGGAATGAAAGTGCAGG + Intergenic
905017876 1:34789940-34789962 GTAGGGAGGAGTGAGAGTGCAGG - Intronic
905539607 1:38749445-38749467 GAGAGGAGGAGTGAAGGGGGAGG + Intergenic
905892795 1:41527773-41527795 GTGAGAACGAGTGTGAGTGCAGG - Intronic
906265892 1:44429076-44429098 AAGAGTAGGAATGAAAGTGCAGG - Intronic
908509362 1:64839360-64839382 GTGACGTGGAGAGACAGTGCTGG + Intronic
909554204 1:76934687-76934709 GTGAGAAGTAGTGAAAGCCCAGG + Intronic
909556369 1:76958849-76958871 GGGAGGAGGCTTGAGAGTGCAGG - Intronic
910372489 1:86531565-86531587 GAGAGGAGGAGTAAAAGACCTGG + Intergenic
910594583 1:88965793-88965815 GAGAGTAAGAGTGCAAGTGCAGG + Intronic
910796214 1:91100137-91100159 GAGAGGCAGAGTGAAAGTGAGGG - Intergenic
910804353 1:91175633-91175655 GTGAAGATGAATGAATGTGCGGG + Intergenic
911653147 1:100412293-100412315 GTGAGGAGTACTTAAAGTGGGGG + Intronic
912831559 1:112957511-112957533 GTGAGGGGGAGGGTAAGTGAGGG - Intergenic
914344582 1:146787741-146787763 GGCAGGAGCAGTCAAAGTGCTGG - Intergenic
914513415 1:148353844-148353866 GAGAGGAGGAGGGACATTGCAGG - Intergenic
915518778 1:156429385-156429407 GTGAGGAGGAGAGACTGTTCGGG + Exonic
916212522 1:162370515-162370537 GTGAGGGGGAGAGAAGGAGCAGG - Intronic
917778067 1:178360197-178360219 GGGTGGAGGAGTGAAAGAACTGG - Intronic
919600733 1:199619269-199619291 AGGAGGAGAAGTAAAAGTGCGGG - Intergenic
919632594 1:199973529-199973551 GTAAGGAGGATTGGAAGTGTAGG + Intergenic
919846798 1:201647872-201647894 TTGAGGAGGTGTGGAGGTGCAGG - Intronic
919847617 1:201651411-201651433 GTGGGGAGGAGGGCAGGTGCAGG + Intronic
920191478 1:204196695-204196717 GTGTGGAGGATGGAAAGAGCCGG - Intergenic
921423110 1:214971692-214971714 GTGAGGAGGACATAGAGTGCAGG - Intergenic
921550290 1:216527240-216527262 GAGGGGAGGAGAGAAAGTGATGG - Intronic
922456365 1:225776903-225776925 GTGAGGAGGAGGGAAAAGTCGGG - Intergenic
923665274 1:235993449-235993471 GTGAGGAGGAGAGGAAGCACGGG + Intronic
923744165 1:236685544-236685566 GTGAGGAGGAGAGAAAGAAGAGG + Intergenic
924498820 1:244616579-244616601 GTGAGGGCGAGTGAGAGGGCAGG + Intronic
924678388 1:246204260-246204282 GTGAGGATGAGTGACAGGTCAGG - Intronic
1062907351 10:1187729-1187751 GTGTGGAGCAGTGCACGTGCTGG - Intronic
1063368622 10:5507035-5507057 GTGCAGAGGAGAGCAAGTGCCGG - Intergenic
1065278823 10:24114080-24114102 GTGAGGAAGAGTTATAGTACAGG - Intronic
1066033932 10:31461186-31461208 GGGAGGAGCAGTGAAAGAGAAGG + Exonic
1066309364 10:34180783-34180805 GGGAGGAGGAGTCTAAGTGCTGG + Intronic
1066622619 10:37374408-37374430 GTCAGGAGGATTAAAAGTGGTGG - Intronic
1067146881 10:43700824-43700846 TGGAGGACGACTGAAAGTGCGGG - Intergenic
1067186046 10:44029077-44029099 CTGAAGAGGAGTGACAGTGAGGG + Intergenic
1067469324 10:46524642-46524664 GGGAGGAGGAGTTTCAGTGCTGG + Intergenic
1067725893 10:48770694-48770716 ATGGGGAAGAGTGAAAGTGATGG + Intronic
1068397932 10:56487999-56488021 GACAGGAGCAGTGACAGTGCTGG + Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1072765865 10:98094793-98094815 GAGAGTAGGTGTTAAAGTGCAGG + Intergenic
1074136558 10:110632386-110632408 GTGAGGAACAGTGAGTGTGCTGG + Intergenic
1075044308 10:119133951-119133973 GGGAGGGCAAGTGAAAGTGCTGG + Intronic
1075090821 10:119443495-119443517 GTGAGGAGGAGGGAGACAGCTGG - Intronic
1075370091 10:121928193-121928215 GTGAGGCGGAGAGACAGAGCGGG + Intronic
1075482113 10:122790654-122790676 GTGCAGAGCAGTGAAAGTGATGG - Intergenic
1075680884 10:124330398-124330420 GGGATGAGGTTTGAAAGTGCTGG - Intergenic
1075685992 10:124365496-124365518 GTGAGGATGAATGAGGGTGCTGG + Intergenic
1075894022 10:125978808-125978830 GTGAGGTGCAGTGGAAGTGGGGG + Intronic
1076235549 10:128861316-128861338 GTGATGAGGTGTGAACGCGCTGG + Intergenic
1076624967 10:131816110-131816132 TTGACGAGAAGTGAAAGTTCAGG - Intergenic
1076858486 10:133128757-133128779 GTGAGGACGTGTGGCAGTGCTGG + Exonic
1077020205 11:413929-413951 GTAGGGAGGAGAGAAGGTGCAGG - Intronic
1078599971 11:12721484-12721506 GTGGGGAGGAGAGAAGGGGCAGG + Intronic
1079319761 11:19442193-19442215 ATGGGGAGGAGGGAGAGTGCAGG - Intronic
1079427447 11:20356954-20356976 TTGAGGTGGAGTGATAGTGGGGG + Intergenic
1080104159 11:28494426-28494448 GTAAGTAGGAGTGTAGGTGCTGG + Intergenic
1081684393 11:45031830-45031852 GTCAGGAGGAATGAAGGTACTGG - Intergenic
1082757649 11:57093577-57093599 GTGAGGGAGAGGGAAAGTGCTGG - Intergenic
1083383910 11:62293248-62293270 GGGAGGAGGAATGTAACTGCAGG - Intergenic
1083837642 11:65282348-65282370 GTGGGGAGGAGCGAGAGGGCAGG - Intronic
1083952954 11:65966868-65966890 GTGAGGATGAGTGACAGCGTGGG + Intronic
1084929834 11:72546208-72546230 GTGGGGAGGATGGAAAGGGCTGG - Intergenic
1085322211 11:75582326-75582348 TGGAGAGGGAGTGAAAGTGCAGG + Intergenic
1088186573 11:107177323-107177345 GTGAGTGGAAGGGAAAGTGCAGG + Intergenic
1088363689 11:109017281-109017303 GAGAGGTGGAGTAAAAGTCCGGG + Intergenic
1089149820 11:116356099-116356121 CTGAGGCAGAGAGAAAGTGCTGG - Intergenic
1089358011 11:117868184-117868206 GTGAGGACGGCCGAAAGTGCTGG + Intronic
1089390710 11:118099759-118099781 GTGAGGAGGGGAGAAAGAGGAGG + Intronic
1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG + Intergenic
1094844383 12:34355046-34355068 AGGAGGAGGATTGAAAGTGTAGG - Intergenic
1095683359 12:45004279-45004301 GAGAAGAGCAGTGAAAATGCAGG - Intergenic
1095813428 12:46396071-46396093 GTGGGGAGGAATGACATTGCTGG + Intergenic
1096122615 12:49097921-49097943 GTGAGAGGGAGTGAGGGTGCAGG - Intronic
1096873513 12:54609758-54609780 GTAAGGAAGATTGAAAATGCTGG - Intergenic
1097465521 12:59919939-59919961 GTGAGGAGGAGCAAAGTTGCTGG - Intergenic
1099539299 12:83885907-83885929 GTGGGCAAGAGTGAAAGTTCAGG + Intergenic
1099600902 12:84736229-84736251 GTGAGGTTGTGTGAAAGTGAGGG - Intergenic
1099871263 12:88352122-88352144 GTGAGGTGGAATAACAGTGCAGG + Intergenic
1101830222 12:108251151-108251173 CTCAGGAGGACTGAGAGTGCTGG + Intergenic
1101879183 12:108614785-108614807 GTGAGGAGGAGTGAGAGGGCCGG + Intergenic
1104133669 12:125917750-125917772 GGGAGGAGGGGTGGAAGCGCTGG + Intergenic
1104328730 12:127824585-127824607 GTGAGGAGGAAGAGAAGTGCTGG - Intergenic
1104600625 12:130150934-130150956 ATGAGGAGGACTGAAATTCCAGG - Intergenic
1104899635 12:132181933-132181955 GAGAGGAGGAGCGGAGGTGCAGG - Intergenic
1105480630 13:20772635-20772657 GGGGAGAGGAGTGAAAGAGCAGG + Intronic
1105628015 13:22132719-22132741 TTTAGGAGGAGTGAAAGAGGTGG - Intergenic
1106334094 13:28766725-28766747 GAGAGGAGGAGTCAAGGTTCAGG + Intergenic
1106417389 13:29557734-29557756 GTGAGGAGGAGTGAATGTGAGGG + Intronic
1106417758 13:29559549-29559571 GTGACGGGGAGTGAATGTGAAGG + Intronic
1107447398 13:40481138-40481160 CAGAGGAGCAGAGAAAGTGCTGG + Intergenic
1107470386 13:40686029-40686051 GTAAGGAGGAGTGTAAGAACTGG + Intergenic
1108095273 13:46894310-46894332 GGTAGGAGGAGTGACAGAGCGGG - Intronic
1109579167 13:64303057-64303079 ATGATTAGGAGTGAAAATGCTGG - Intergenic
1110228662 13:73145942-73145964 GTGAGGAAGAGTGACAGTAATGG + Intergenic
1110756189 13:79177157-79177179 GGCAGGAGGAGAGAAAGGGCAGG - Intergenic
1111963254 13:94834348-94834370 GTGAGGAGGCAGGAAAATGCCGG + Intergenic
1113720566 13:112553006-112553028 GTGAGGAGGAGTGTGGGTGGTGG - Intronic
1114642794 14:24235461-24235483 GTCAGAAGCAGTGAATGTGCTGG + Intronic
1118063231 14:62163544-62163566 GGGATGAGGAGGGAAAGTGAGGG - Intergenic
1118065990 14:62190607-62190629 GAAAGGAGGAGTGAAGGTGATGG - Intergenic
1118603734 14:67488308-67488330 CCGAGGAGAAGTGAAAGGGCAGG + Intronic
1118775693 14:68972699-68972721 TTGAGAAGGAGTGCAAATGCTGG + Intronic
1118820509 14:69342410-69342432 GTGAGGAAGAGGGAAGGTGAGGG + Intronic
1119262333 14:73245249-73245271 GTGAGGAGGAATGAGAGACCAGG + Intronic
1119496460 14:75083888-75083910 GTGAGGAATAGAGAAAGGGCAGG - Exonic
1120680058 14:87470527-87470549 GGGAGGAGGAAGGAAAGGGCTGG + Intergenic
1121417209 14:93787878-93787900 GTAAGCTGGAGTGTAAGTGCAGG - Intronic
1122988283 14:105223234-105223256 TTGCTGAGGAGTGAAATTGCTGG - Intronic
1124199044 15:27660696-27660718 GTGGGGAGGAGGGCAAGTGAGGG - Intergenic
1127396958 15:58550705-58550727 GTGAGGAGGAGGTTAAGGGCAGG + Intronic
1127635161 15:60862208-60862230 GTGAGAAGGAGTGAAAATCAAGG - Intronic
1128669335 15:69562835-69562857 GTGAGGAGGAGTCAAGGTCTGGG + Intergenic
1129462191 15:75705017-75705039 GTGAGGAGAAGAGAATGAGCAGG - Intronic
1129504725 15:76071771-76071793 GAGAGGAGGAGAGAAAGTGCAGG + Intronic
1129977143 15:79831838-79831860 GGGAGGAGGAGTGAAAGGACAGG - Intergenic
1132087222 15:98918277-98918299 GTGAGGGGAAGGGAACGTGCTGG - Intronic
1132172788 15:99679201-99679223 ATAAGGATGAGTGAAAATGCTGG - Intronic
1133224359 16:4333520-4333542 GTAAGGAGGGGTGAGAGTTCCGG + Intronic
1133248249 16:4463397-4463419 GCAAGGAGGGGTGAAAATGCAGG - Intronic
1133662443 16:7931903-7931925 GAGAGGAGGAGAAAAAGAGCAGG - Intergenic
1134332391 16:13263101-13263123 GTGAGGTGGAGTGAAGGCTCTGG - Intergenic
1134377471 16:13690799-13690821 GAGAAGGGGAGTGAAAGCGCAGG - Intergenic
1135984813 16:27176369-27176391 CTGAGGAGGAGGGATAGTGGGGG - Intergenic
1136367171 16:29814187-29814209 GGAAGGAGGAGTGAAGGGGCAGG - Intronic
1137009477 16:35308920-35308942 AAGAGGAGGAGTGGAACTGCAGG - Intergenic
1137321314 16:47386306-47386328 AGGAGGAGGAGAGAAAGAGCAGG - Intronic
1137477519 16:48822610-48822632 TTGAGCAGGAGTGGAATTGCTGG + Intergenic
1137703409 16:50516179-50516201 GGGAGGAGAAGTTAAAGTGTAGG - Intergenic
1137715012 16:50593210-50593232 GTGAGGAGGAGCGAGTGAGCAGG + Intronic
1138183464 16:54959131-54959153 GGGTGGTGGAGGGAAAGTGCAGG + Intergenic
1138532019 16:57639703-57639725 GGGAGCAGGAGTGAAAGGGACGG - Intronic
1138657562 16:58499950-58499972 GGGAGGAGCAGTGACAGGGCTGG + Intronic
1139332013 16:66200199-66200221 GTATGTAGGAGTGAAATTGCCGG - Intergenic
1139989410 16:70927565-70927587 GGCAGGAGCAGTCAAAGTGCTGG + Intronic
1141672384 16:85499073-85499095 GTGCAGAGGAGTGAGACTGCAGG + Intergenic
1141808637 16:86358858-86358880 GTGTGGAGCAGTGAAAGCACAGG + Intergenic
1142184480 16:88688020-88688042 GTGAGGGGGAGTGGAAGGACAGG + Intergenic
1142328179 16:89431988-89432010 GTAGGGAGGAGTGACAGTGATGG - Intronic
1142587061 17:980138-980160 CTGGGGAGGAGAGAAAATGCGGG - Intergenic
1142587090 17:980234-980256 GAGAGGAGGAGGGAAAGGCCGGG - Intergenic
1143888227 17:10082624-10082646 GTACGTAGGAGTGAAATTGCTGG - Intronic
1143943061 17:10563227-10563249 GTGAGTAGGAGTGAACGTGAAGG + Intergenic
1144624716 17:16838850-16838872 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1144881714 17:18433871-18433893 GTGAGGAGGGGTCAGAGTGTGGG + Intergenic
1145150519 17:20510515-20510537 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1146409724 17:32572216-32572238 GCGAGGGGGAGTAAAAGTGCTGG - Intronic
1147120735 17:38333815-38333837 GTGAGGACGACAGAAGGTGCTGG - Intronic
1147578856 17:41617544-41617566 GTGAGGAGGGGTCAGAGTGTGGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148970998 17:51481554-51481576 CTGAGTAGGAGTGCAAGTGTAGG + Intergenic
1149461355 17:56832677-56832699 GGGAGGAGGAGGGAATGTGAAGG - Intronic
1149584527 17:57776650-57776672 GTGGGAAGGAGGGAGAGTGCAGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152178186 17:78801511-78801533 GTGAAGGGGAGAGAAAGTCCTGG - Intronic
1152388429 17:79988940-79988962 GGCAGGAGGACTGAAGGTGCTGG - Intronic
1152744787 17:82033667-82033689 GTGAGGAGGGGAGACAGTGAGGG - Intronic
1153611666 18:6891928-6891950 AGGAGGAAGAGTGAAAGTCCAGG + Intronic
1153699393 18:7677662-7677684 GTGAGTAGGAGGGAAGTTGCAGG - Intronic
1155917207 18:31568546-31568568 GGGAGCAGGAGAGAAAGGGCTGG - Intergenic
1156353572 18:36322210-36322232 GTGAGGAGGAATGGCAGAGCTGG + Intronic
1156701534 18:39831717-39831739 GTGCGGAGGAGGGAAAGTTCTGG - Intergenic
1157286083 18:46378413-46378435 GTCAGGGGGAATGAATGTGCTGG - Intronic
1159367827 18:67492424-67492446 GTGAGAAGCAGTGAAAGTTTTGG + Intergenic
1161103972 19:2434240-2434262 GTGAGGAGGAGGGGCAGGGCAGG - Intronic
1163337364 19:16682064-16682086 TTGAGGAGGAGAGAGACTGCGGG + Intronic
1163348979 19:16763460-16763482 GTCTGGAGGTGTGAAAGAGCAGG - Intronic
1163551781 19:17969530-17969552 GGGAGGAGGAGAGAAATGGCAGG - Intronic
1164814665 19:31186180-31186202 GTGTGTAGGAGTGGAATTGCTGG + Intergenic
1165001920 19:32771133-32771155 GAGAGGAAGAGAGAAAGTGGAGG + Intronic
1165939872 19:39409730-39409752 GTGGGGAGGACGGAATGTGCTGG + Intergenic
1166339552 19:42129460-42129482 CAGAGGAGAAGTGAAAGTCCGGG - Intronic
1166387411 19:42389916-42389938 TTGCAGAGGAGTCAAAGTGCTGG - Intronic
1168565258 19:57416987-57417009 GTGAGGAGCACTGAAGGTCCTGG + Intronic
928355370 2:30608452-30608474 GTGAGGGTGAGTGAATGTGAAGG - Intronic
929237344 2:39619899-39619921 TTGAGTAGTAGAGAAAGTGCTGG - Intergenic
929779051 2:44946127-44946149 GTGAGCAGGAGTGGAAGTGAAGG - Intergenic
929853301 2:45612613-45612635 GTGAGGAGGAGAGTAAGAGTGGG + Intergenic
930691979 2:54373639-54373661 TTGAGGAGGAGGCAAAGTGTTGG - Intronic
932299687 2:70657534-70657556 GTGAGGTGGAGTGGAAGTGTGGG + Exonic
933190987 2:79333231-79333253 GTGAGGAGAACTGAAGGAGCAGG + Intronic
935145998 2:100395864-100395886 GGGAGCAGGAGTGGAAATGCTGG + Intronic
935442794 2:103122139-103122161 GTGAGGAGAAGGGAAAGAGGAGG - Intergenic
937496217 2:122422934-122422956 GTAAGGAGGAGTACAAGTCCAGG - Intergenic
938285124 2:130106623-130106645 GTGATGAGGAATGAAAGTTTTGG - Intronic
938430479 2:131232269-131232291 GTGATGAGGAATGAAAGTTTTGG + Intronic
938620262 2:133044701-133044723 ATAAGTAGGAGTGAAATTGCTGG - Intronic
938714986 2:134010974-134010996 GAGAGGAGGCCTGCAAGTGCAGG - Intergenic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
940280797 2:151987686-151987708 ATGAAGAGGAGGGAAAGTGCTGG - Intronic
941647800 2:168059799-168059821 GTGAGGAGGATAGAAAGTGAGGG - Intronic
941687739 2:168464611-168464633 GTGAGGCAGAGAGAAAGGGCTGG + Intronic
941737470 2:168994866-168994888 GTAAGGAGCAGAGTAAGTGCCGG + Intronic
942525606 2:176849610-176849632 GTGATGTGGAGTGAGTGTGCAGG + Intergenic
945148596 2:206764585-206764607 GAGAGAATGATTGAAAGTGCTGG - Intronic
945321046 2:208424147-208424169 GTCAGGAGGGGTGGAAGTCCAGG + Intronic
945475460 2:210276864-210276886 GTGAGGAGTAGTGAAAGATGAGG + Intergenic
946281845 2:218671642-218671664 TTGAGGAGGAGAGAAAGGGATGG + Intronic
946325899 2:218984650-218984672 GTGAGGAGCCGTGAGAGCGCAGG + Intronic
947571565 2:231239757-231239779 CTTGGGAGGAGTGAAAGTACCGG - Intronic
947796839 2:232898454-232898476 ATGAGGAGGGGTGAGAGTTCTGG - Intronic
1169046377 20:2537270-2537292 ACGAGGCGGAGTGAAAGGGCGGG + Exonic
1172271931 20:33659798-33659820 GTGAGGGGCAGTGAAGGAGCGGG + Intronic
1172416603 20:34773884-34773906 TTCAGCAGGAGTGAAAGTGATGG - Intronic
1172888514 20:38247408-38247430 GTGAGGAGGGGTGGAAGTGAAGG - Intronic
1173002036 20:39111621-39111643 GAGAGGAGGAGGGAAAGGGGAGG + Intergenic
1173577539 20:44122901-44122923 GGGAGGAGGAGGGAAAGGGCTGG + Intronic
1175417605 20:58811995-58812017 GTGAGGAGCAGGGAGAGTGGTGG - Intergenic
1175679962 20:60978891-60978913 GTGCGGAGGAGTAGAACTGCTGG + Intergenic
1176010456 20:62890902-62890924 GGGAGGAGGGGTGCAGGTGCAGG + Intronic
1176273303 20:64247664-64247686 GTGAGGAGTGGTGGAAGAGCTGG + Intergenic
1177193812 21:17881317-17881339 GTAAGGAGGAGTGAATTTGAAGG - Intergenic
1177741259 21:25156011-25156033 GAGATGAGGAGTAAAAGTGCAGG - Intergenic
1178107845 21:29340280-29340302 CTGTGTAGGAGTTAAAGTGCAGG + Intronic
1178997906 21:37423299-37423321 GGGAGGAGGAGGGAATATGCGGG - Intronic
1180059077 21:45375474-45375496 GGGAGGAGGAGGGACACTGCAGG + Intergenic
1180059092 21:45375514-45375536 GGGAGGAGGAGGGACACTGCAGG + Intergenic
1180079352 21:45479825-45479847 GGGAGGAGCACTGAGAGTGCTGG + Intronic
1182282559 22:29225782-29225804 GTGAGGAGGGGAGAGACTGCTGG + Intronic
1182945550 22:34318049-34318071 GGGAGGAGGAGGGAAAGGGATGG + Intergenic
1183016527 22:34992848-34992870 GTCAGGAAGAGTGATGGTGCAGG - Intergenic
1184582946 22:45429499-45429521 GGGAGGAGGAGGGACAGTGGCGG + Intronic
1184816411 22:46875037-46875059 GTGTGAAGGAGTGGAACTGCTGG - Intronic
1184859451 22:47164984-47165006 GGGAGTAGGAGTGACAGTGAGGG + Intronic
1185097703 22:48820772-48820794 GGGAGGAGCACAGAAAGTGCAGG + Intronic
949377063 3:3401999-3402021 GGGAGGAGCAGTAAAAGTGCAGG + Intergenic
949645417 3:6088116-6088138 GAGAGGAGGCTTGAAAGAGCAGG + Intergenic
949895517 3:8765263-8765285 GAGAAGAGGAGTGCAAGTGAGGG + Intronic
950904046 3:16521533-16521555 GTCTGGAGGAGGGAAAGAGCAGG - Intergenic
952142347 3:30494101-30494123 GGGAGGAGGAGTGATATTGGTGG - Intergenic
952144984 3:30522705-30522727 GTGAGGCAGAGTGAAAGAGGAGG - Intergenic
952849955 3:37719652-37719674 GTCAGGAGGGCTGGAAGTGCAGG + Intronic
953133904 3:40166603-40166625 GGGAGGAGGAATGAGATTGCAGG + Intronic
953759864 3:45678198-45678220 GTGTGGAAGACTGAAAGTGAAGG - Exonic
954254960 3:49398468-49398490 GTAAGGAGCAGTGAAAGGGTAGG + Intronic
954335306 3:49912933-49912955 GTGAGGAGGGGAGAAGGAGCCGG + Intronic
954866229 3:53732273-53732295 GTGATGGGGAGGGAAAGTGCAGG + Intronic
954883118 3:53849126-53849148 GTTAGGAGGTGGGAAAGTGGGGG + Intronic
955550597 3:60080898-60080920 AAGAGGAGGAGTGAAAGAGAGGG + Intronic
956096183 3:65718941-65718963 GTGAGGAGCAGAGAGAGGGCAGG - Intronic
956555186 3:70513657-70513679 GTGATGAGACCTGAAAGTGCAGG - Intergenic
958870389 3:99551719-99551741 GTGAGGAGGAGTGAAGAGGAGGG + Intergenic
958880551 3:99664568-99664590 GGGAGGAGGAGTAAAAGAGCAGG - Intronic
959002326 3:100978919-100978941 GGTGGGAGGAGTGAAAGTGGGGG + Intronic
960001309 3:112734924-112734946 GTGAAGTGGAGTGAAACTGGAGG - Intergenic
960044174 3:113180166-113180188 GTGAGGACTAGTGACAGAGCTGG - Intergenic
960054615 3:113268274-113268296 GTGAAGAGAAGGGAAGGTGCTGG - Intronic
961034702 3:123634405-123634427 CTGAGGAGGGGTCACAGTGCCGG - Intronic
961636356 3:128335424-128335446 GTGAGGAAGAGAGGAACTGCAGG + Intronic
961801326 3:129452392-129452414 ATGAGGGGGATTGAGAGTGCTGG + Intronic
961966853 3:130914044-130914066 AGGAGGAGGAGGGAAAGAGCAGG - Intronic
964027582 3:152096497-152096519 GTGTGGAAGAGTGGAAGAGCTGG + Intergenic
965986253 3:174757348-174757370 ATGAGGAGGTGTTAAAGTGAAGG + Intronic
966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG + Intronic
967597588 3:191345439-191345461 GAGAGGAAGAGTGAAAAAGCAGG - Intronic
967723916 3:192843980-192844002 GAGAGGAGGAGTGGGAGTTCCGG - Intronic
968883135 4:3311499-3311521 GAGTGAAGGAGTGACAGTGCGGG + Intronic
969069750 4:4526271-4526293 ATGAGACGGAGAGAAAGTGCAGG + Intronic
971485687 4:27157658-27157680 GTGAGGAGGAGTCGAGGAGCCGG + Intergenic
973610969 4:52635749-52635771 GTGAGGAGGAGGGTAACTGGAGG - Intronic
975330223 4:73104452-73104474 GAGAGGAGGAGTGAAAGCAAAGG + Intronic
975676398 4:76831637-76831659 GTGTGGAGCAGTGGAAGGGCTGG + Intergenic
976120668 4:81777722-81777744 GGGAGGTGGAGTGAAAGGGGAGG - Intronic
979239571 4:118436361-118436383 CTGAGGAGGTGGGAATGTGCTGG - Intergenic
981320864 4:143389528-143389550 GAGATAAGGAGGGAAAGTGCAGG + Intronic
982097704 4:151937872-151937894 GTCAGGAGGAGTGAGCATGCAGG + Intergenic
982845555 4:160247473-160247495 GCGAGGGAGAGTGCAAGTGCAGG - Intergenic
983595106 4:169457630-169457652 GGGAGAAAGAGAGAAAGTGCGGG + Intronic
983941072 4:173534697-173534719 AAGAGGAGGAGGGAATGTGCAGG - Intergenic
984784169 4:183552848-183552870 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784176 4:183552958-183552980 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784185 4:183553050-183553072 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784188 4:183553078-183553100 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784191 4:183553106-183553128 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784207 4:183553231-183553253 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784225 4:183553379-183553401 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784228 4:183553407-183553429 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784246 4:183553553-183553575 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784249 4:183553581-183553603 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
984784252 4:183553609-183553631 GTGAGGATGAGTGTGAGTGTGGG + Intergenic
985000196 4:185474949-185474971 GTGAGGATGAGTGAAATCCCAGG + Intergenic
985531960 5:438989-439011 GGGGTGAGGAGTGAAAATGCGGG - Intergenic
985813866 5:2111834-2111856 GGGAGGAGGAGAGGAAATGCGGG - Intergenic
987244933 5:16039197-16039219 GCGAGGAGGCGTGGAAGTGAGGG - Intergenic
987591547 5:19934256-19934278 GTGAGAAGGACTTAATGTGCTGG + Intronic
989604480 5:43230769-43230791 TTGGGGAGGAGTGAAAATGACGG - Intronic
990484813 5:56247808-56247830 GAGGGGAGGAGTGAGATTGCTGG - Intergenic
991088466 5:62670676-62670698 GTGATGAGGAGGGAAAATGTGGG + Intergenic
992631938 5:78690188-78690210 GAGAGGGAGAGTGAATGTGCAGG - Intronic
992695109 5:79278379-79278401 TAGAGGAGGAAGGAAAGTGCAGG - Intronic
992788124 5:80189231-80189253 GAGAGGAGGAGTGGAGGTGCCGG + Intronic
993379641 5:87191715-87191737 TGGAGGTGGAGTGAAGGTGCAGG + Intergenic
993787033 5:92154185-92154207 GGGCCGAGGAGTGAAATTGCTGG + Intergenic
993828303 5:92721181-92721203 GTGAAGAGGATTGAGAGTGTTGG - Intergenic
993900739 5:93582896-93582918 GGGAGGAGGAGAGAAAGTGAGGG - Intergenic
995623973 5:114056589-114056611 GAGGGGAGGAGTGAAAGCCCAGG - Intergenic
995855117 5:116583608-116583630 GTGAGGAGGAGTAAAGGTTTAGG - Intergenic
999192587 5:149759657-149759679 GTGAGGATGAGGGAAGGAGCCGG - Intronic
999246639 5:150158424-150158446 GAGAGGAGGAGTGACAGTCCTGG - Intergenic
1000127588 5:158261722-158261744 GTGAGGAGGAGGGGAAGAGATGG + Intergenic
1000308159 5:160015166-160015188 GAAAGGAGGAGGGCAAGTGCTGG + Intronic
1000692055 5:164336345-164336367 GGGATGAGGAGTGATAGAGCTGG + Intergenic
1000770713 5:165350237-165350259 GTGAGTATGAGTGAAAGTGGTGG - Intergenic
1002643834 5:180643439-180643461 GAGGGGAGGAGGGAAAGTGGAGG - Intronic
1002739821 5:181426949-181426971 CTGAGGAGGTGGGAATGTGCTGG - Intergenic
1002773433 6:308510-308532 GTGAGGAAGAGGGGAGGTGCTGG + Intronic
1003381517 6:5628698-5628720 GAGAGATGGAGGGAAAGTGCTGG + Intronic
1003508552 6:6760082-6760104 GTGAGGAGGAGGGCAAGGACTGG - Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1004939253 6:20539042-20539064 GTTAGAAGCAGTGAAAGTGTGGG + Intronic
1005841792 6:29748646-29748668 GAGGAGAGGAGAGAAAGTGCAGG + Intergenic
1006411254 6:33875136-33875158 GTGAGGAGGACAGGAGGTGCTGG + Intergenic
1007237673 6:40402692-40402714 TTGAGGAAATGTGAAAGTGCTGG - Intronic
1008669306 6:53750688-53750710 GTGAGGAGAACTGGAAGTGGAGG + Intergenic
1008924354 6:56876442-56876464 TTGAAGAGGAGTGAGAGAGCTGG - Intronic
1009737626 6:67697809-67697831 GTGAGGTGGAGAGAAAGAGTGGG + Intergenic
1010148122 6:72696109-72696131 ATGCGGAGAAGTGAAATTGCTGG - Intronic
1010309625 6:74369596-74369618 GTGAGTGGGAGTGAATGTGAAGG - Intergenic
1011402841 6:86982488-86982510 CTGAGGAGGAGTGAGAATCCAGG + Intronic
1011495846 6:87936089-87936111 GTGGGGAGGAGAGAAACTGGGGG + Intergenic
1012170983 6:96016213-96016235 GTGAGTAGGCGGGAGAGTGCAGG + Intronic
1012465866 6:99515536-99515558 GCGGGGAGGGGTGAAAGGGCGGG + Intronic
1014573917 6:123046189-123046211 TTGAGGCAGAGTGAAAGAGCAGG - Intronic
1015553610 6:134437993-134438015 GAGGGGAGGAGAGAGAGTGCTGG + Intergenic
1016890708 6:149004402-149004424 GTGGGGAGCAGTGTAAGAGCCGG + Intronic
1017037065 6:150276225-150276247 GGGTGAAGGAGTGAAAGTGAGGG - Intergenic
1017229272 6:152054795-152054817 GTGAGGAGGAAAGAAATTTCAGG - Intronic
1017454719 6:154591112-154591134 GTGAGGAGGTGGGAAAGGGCTGG + Intergenic
1017564164 6:155666365-155666387 GTGAGGTGGAGTCAAGCTGCAGG + Intergenic
1017606798 6:156143490-156143512 AGGAGGAGGAGTGAAAGAGAGGG + Intergenic
1017889471 6:158626841-158626863 GTGAGGATGTGTGAAAATGAGGG - Intronic
1017889519 6:158627147-158627169 GTGAGGATGTGTGACAGTGAGGG - Intronic
1019244934 6:170702535-170702557 CTGAGGAGGTGGGAATGTGCTGG - Intergenic
1020080124 7:5282506-5282528 GGGAGGAGGAGAGAAAGGGAAGG + Intronic
1021452721 7:20797899-20797921 GTGAGGAGGAAGGAAAGGGAGGG - Intergenic
1022726616 7:32987106-32987128 GTGAGCAGGGGTGATAGTGGGGG + Intronic
1022897140 7:34761874-34761896 GTGAGGAGGAGAAATAGTGGAGG + Intronic
1024569805 7:50714076-50714098 GTGAGGAGGGGTGAAGGTAGGGG - Intronic
1025198795 7:56949704-56949726 GGGAGGAGGAGAGAAAGGGAAGG - Intergenic
1025673151 7:63627229-63627251 GGGAGGAGGAGAGAAAGGGAAGG + Intergenic
1026079545 7:67205491-67205513 GCTAGGTGGAGTGAAAGTCCAGG + Intronic
1026697302 7:72606491-72606513 GCTAGGTGGAGTGAAAGTCCAGG - Intronic
1027266832 7:76499145-76499167 GTGAGGAGGTGTGGAGGTGTGGG + Intronic
1028148781 7:87347823-87347845 GTAAAAAGGAGGGAAAGTGCAGG + Intronic
1028288361 7:89033114-89033136 GGGAGTAGGAGTGGAAGTGGTGG - Intronic
1034027745 7:147725544-147725566 GAGAGGAGGAGAGAGAGTGGGGG - Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035503189 8:105652-105674 CTGAGGAGGTGGGAATGTGCTGG + Intergenic
1037008679 8:13813389-13813411 GTGATGATGGGTGAAAGTGCTGG + Intergenic
1037802376 8:22042783-22042805 GCGAGGAGGAGAGAAAGGGGAGG - Exonic
1037877224 8:22554165-22554187 GTGAGGAGGAGGGGAGGGGCTGG - Intronic
1039214988 8:35259840-35259862 GTGGGGAGGGGTGAGAGGGCAGG + Intronic
1039295509 8:36147519-36147541 AGGAGGAGGAGTGAAAGAGAAGG - Intergenic
1040705565 8:50122350-50122372 GGGAGAAGTAGTGAAAGTGAGGG + Intronic
1041321000 8:56612401-56612423 GAGAGGCTGAGTGAAACTGCAGG + Intergenic
1042025124 8:64415040-64415062 ATGTGGAGGAGAGAAAGGGCAGG - Intergenic
1044632141 8:94290368-94290390 GTGAGGAGAAGTGAGAGAGAGGG - Intergenic
1044725953 8:95194434-95194456 GTGAGGAGGAGTAGAAATGTGGG + Intergenic
1044973024 8:97638316-97638338 GGGAGGAGGATTTAAAGTCCTGG - Intergenic
1044994788 8:97828954-97828976 GTAAGGAAGATTTAAAGTGCAGG + Intronic
1045064783 8:98435570-98435592 GTGGGGAGGAGGGGCAGTGCAGG + Intronic
1045277570 8:100721628-100721650 GAGAGGAGGAGAGCGAGTGCCGG + Exonic
1045340071 8:101245751-101245773 GTCTGGAGGAGTTTAAGTGCAGG + Intergenic
1045858078 8:106787587-106787609 GTGAGGGTGAGTGAATGTGAGGG + Intergenic
1046104385 8:109648658-109648680 GTGAGGAAGAGTGAATGTGAGGG - Intronic
1046962383 8:120124987-120125009 AGGAGGAGGAGAGAAAGTGGGGG + Intronic
1047458369 8:125037739-125037761 GAGAGGAGGAGGGAGAGTGAAGG + Intronic
1049116863 8:140696354-140696376 GTGAGCATGTGTGAGAGTGCAGG + Intronic
1049826357 8:144671385-144671407 GTTAGGAAGAGTGAAAGGGTTGG - Intergenic
1050188846 9:3003833-3003855 TAGAGGAAGAGTGAAAGTGTTGG + Intergenic
1050910254 9:11059309-11059331 ATGAGGATGAGTCAAAGTTCAGG - Intergenic
1051226967 9:14909398-14909420 GTGGGGAAGAGAGATAGTGCTGG - Intronic
1051418613 9:16870111-16870133 GAGAGGAAGAGTCAACGTGCCGG + Intronic
1051708011 9:19900856-19900878 GTGAGGAGGAGAGAAAGGAATGG + Intergenic
1052642625 9:31188855-31188877 GATAGGAGGAGTGAAAGCACTGG - Intergenic
1053005968 9:34604830-34604852 GTAAGGAAGATCGAAAGTGCTGG + Intergenic
1053477343 9:38392249-38392271 GAAAGGAGCAGTGAAAGTGGAGG + Intergenic
1053750322 9:41246979-41247001 GTGATGGAGAGGGAAAGTGCTGG - Intergenic
1054255825 9:62811317-62811339 GTGATGGAGAGGGAAAGTGCTGG - Intergenic
1054335486 9:63804291-63804313 GTGATGGAGAGGGAAAGTGCTGG + Intergenic
1055626180 9:78179302-78179324 GCGAGTAGAAGGGAAAGTGCAGG + Intergenic
1056779746 9:89540213-89540235 CTCAGGAGGAGTTAAACTGCAGG - Intergenic
1056813617 9:89783379-89783401 AAGAGGAGGAGAGAAAGGGCAGG - Intergenic
1057837412 9:98456153-98456175 TCTAGGAGGAGTGAAAGTGGCGG - Intronic
1057849728 9:98556097-98556119 CAGAGGAGGAAGGAAAGTGCTGG + Intronic
1057969779 9:99543396-99543418 TTGAAGAGAAATGAAAGTGCAGG - Intergenic
1059420212 9:114185989-114186011 GTGCAGAAGAGTGAAAGTTCAGG + Intronic
1059992736 9:119880508-119880530 GTGAAGAGGAGAGAATGAGCAGG - Intergenic
1060045607 9:120337713-120337735 TTGAGGAGGGGGGAAAGTGGAGG + Intergenic
1060215876 9:121737949-121737971 GGGAGGAAGAGTGAAGGTGGGGG + Intronic
1061035388 9:128111109-128111131 GTAAATAGGAGTGGAAGTGCTGG - Intergenic
1203605127 Un_KI270748v1:51756-51778 CTGAGGAGGTGGGAATGTGCTGG - Intergenic
1185991955 X:4901426-4901448 GGGAGGAGGAGTGAAGGTGAGGG - Intergenic
1186801278 X:13094583-13094605 GCCAGGAGGAGTGAAAGCACAGG - Intergenic
1186913587 X:14195729-14195751 GAGAGAGAGAGTGAAAGTGCAGG - Intergenic
1189257245 X:39649996-39650018 GGGAGGGGGAGAGAAAATGCTGG + Intergenic
1189321175 X:40088481-40088503 GAGAGGAGGAGAGAAAGGGAGGG + Intronic
1191019634 X:55845441-55845463 GGGAGGTGGAGTGAAAGGGGAGG + Intergenic
1192341870 X:70269611-70269633 GAGAGGGGGATTGGAAGTGCAGG - Intronic
1192493491 X:71597076-71597098 GTGAGGAGGAGTGAATGGAAAGG + Intronic
1194646127 X:96460486-96460508 GTGTGGGGGAGGAAAAGTGCAGG - Intergenic
1195045297 X:101049997-101050019 GTCAGGAGGAAGGAAACTGCAGG + Intronic
1196351131 X:114731424-114731446 ATGATGACGATTGAAAGTGCTGG - Exonic
1196434942 X:115665924-115665946 GTGAGTGGAAGGGAAAGTGCAGG + Intergenic
1197562514 X:128040996-128041018 GAGAGGAGGGGAGAAAGTGAGGG - Intergenic
1198154532 X:133945828-133945850 GTGAGAGGGTGTGCAAGTGCAGG - Intronic
1198957542 X:142148933-142148955 GTGAGCAGGAGTGTGAGTGTTGG + Intergenic
1199153432 X:144517198-144517220 ATTAGGAGGTGTGACAGTGCCGG - Intergenic
1199612084 X:149627050-149627072 AGGAGGAGTAGTGAAAGAGCGGG - Intronic
1199615386 X:149651653-149651675 TTGAGCAGGAGCGAAAGGGCTGG - Intergenic
1200334640 X:155336668-155336690 GGGAGGAAGAGAGAAAGTGGTGG + Intergenic
1201237172 Y:11922721-11922743 GTGAGTGGAAGGGAAAGTGCAGG - Intergenic
1202387313 Y:24338157-24338179 CTGAGGAGGTGGGAATGTGCTGG - Intergenic
1202483473 Y:25331971-25331993 CTGAGGAGGTGGGAATGTGCTGG + Intergenic