ID: 1004405230

View in Genome Browser
Species Human (GRCh38)
Location 6:15326986-15327008
Sequence TTGTTGTTCTTGAGGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 1, 2: 1, 3: 62, 4: 527}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004405230 Original CRISPR TTGTTGTTCTTGAGGAAATG AGG Intronic
901169347 1:7245096-7245118 TTGTTTTTCTGTAGTAAATGGGG + Intronic
901242300 1:7702625-7702647 TTCTTGTTCTCAAGGAGATGAGG + Intronic
901449929 1:9329684-9329706 TTGTTGTTGTTTTTGAAATGAGG - Intronic
901707141 1:11082659-11082681 TTGCTCTTACTGAGGAAATGTGG - Intronic
902848118 1:19128347-19128369 TCGTTCTTCTTTAGGAAATTGGG - Intronic
903507970 1:23852413-23852435 TTGTTTTTTTTAATGAAATGGGG - Intronic
903575369 1:24336585-24336607 TTATTCTTCTTGAGCAAATCTGG - Exonic
903872665 1:26447821-26447843 TTGTTGTTGTTGTTGAAAAGAGG - Intronic
904114997 1:28155215-28155237 TTGTTGTTGTTGTTGAGATGGGG + Intronic
904202810 1:28832443-28832465 TTGTATTTCTTGTAGAAATGGGG - Intronic
904761284 1:32806056-32806078 TTGTTGTGTTTTAGGAAATGAGG + Intronic
905469488 1:38181141-38181163 TTGTTGTTCTAGTGGAGTTGGGG + Intergenic
905734104 1:40314540-40314562 TTTTTATTTTTGAGGAAAAGGGG - Intronic
905785340 1:40751582-40751604 TTGTTGTTGTTGTAGAGATGAGG + Intronic
906730332 1:48075362-48075384 TTGTTCTTTTTGATGAAATCTGG + Intergenic
907351995 1:53839596-53839618 TTGTTGTTTTTGTGGAGATGAGG - Intergenic
908028468 1:59975065-59975087 TTGTTGTTGTTTTAGAAATGGGG + Intergenic
908087769 1:60654504-60654526 TTGATGTTTCTGAGAAAATGGGG + Intergenic
908460712 1:64346155-64346177 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
908548675 1:65187738-65187760 TTGTTGCTCTTGAAGTAATACGG + Intronic
909704909 1:78569932-78569954 TTGTTGTTTTTGTGGATACGTGG - Intergenic
909969273 1:81960164-81960186 TTGTTTTTCTTGAGGAAGTCAGG + Intronic
910916448 1:92294685-92294707 TTGTTGTTGTTGTTGAGATGGGG + Intronic
911011224 1:93282872-93282894 TTGTTGTTGTTGTTGAGATGGGG - Intergenic
911332138 1:96537580-96537602 TTGTTGTTGTTGCAGAAATGGGG + Intergenic
914436127 1:147661138-147661160 TTGTTTTTCTTTTTGAAATGGGG + Intronic
914766565 1:150642978-150643000 TTGTTGTTGTTGTAGAACTGGGG + Intergenic
915178433 1:154036933-154036955 TTGTACTTTTTGAAGAAATGCGG + Intronic
915779761 1:158534485-158534507 TTGTTTCTCTTTAGGAGATGAGG - Intergenic
916736741 1:167614223-167614245 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917092879 1:171371694-171371716 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
917099187 1:171428737-171428759 TTGTTGTTGTTGTAGAGATGTGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917469363 1:175313588-175313610 TTTTTTTTTTTTAGGAAATGAGG + Intergenic
917819702 1:178749920-178749942 TTGTTGTTTTTGTAGAGATGGGG - Intronic
918632583 1:186735859-186735881 TTGTTTTTCTTGATTAAATTTGG + Intergenic
918831959 1:189409883-189409905 TGGTTTTTCTCAAGGAAATGAGG - Intergenic
919629049 1:199942118-199942140 TTGTGGTTTTTGAGGAAGTTGGG - Intergenic
921168703 1:212526463-212526485 ATGTTGCCCATGAGGAAATGAGG + Intergenic
922292983 1:224224348-224224370 TTGTTCTTTTTGATGATATGGGG + Intergenic
922380989 1:225025557-225025579 TTGTTGTTTTTGTAGAGATGGGG - Intronic
923448035 1:234090778-234090800 TAGTTGTTTTTCAGGAACTGAGG - Intronic
923923322 1:238594564-238594586 TTGTTGTTCTTGTTGTATTGAGG + Intergenic
924006824 1:239621293-239621315 TTGTTGTGACTCAGGAAATGGGG - Intronic
924158551 1:241206680-241206702 TTGGTGTGTTTGAGGAACTGAGG - Intronic
924411975 1:243815787-243815809 TTGTTGTTGTTGTAGAGATGAGG + Intronic
924713580 1:246551681-246551703 TTGTTGTTTTTTAAGAGATGCGG - Intronic
1064201084 10:13285510-13285532 TTGTAGTTCGATAGGAAATGAGG - Intronic
1064299053 10:14105391-14105413 TTTTTGTTTTTGTGGAGATGGGG - Intronic
1064307491 10:14181013-14181035 TTGCTGTTCTTTAGAAAATGGGG - Intronic
1065432882 10:25677085-25677107 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
1066105770 10:32155464-32155486 TTGTTGTTCTTCAGGTTCTGAGG + Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1067498376 10:46779137-46779159 TTGTTGTTGTTGTAGAAATGAGG - Intergenic
1067596272 10:47561278-47561300 TTGTTGTTGTTGTAGAAATGAGG + Intergenic
1068951263 10:62779964-62779986 TTTTTGTTTTTGTGGAGATGAGG - Intergenic
1069044962 10:63733624-63733646 TTCTTGTTCTGGAGGAAACTTGG + Intergenic
1069138601 10:64796513-64796535 TTTTTGCTCTTGAGAAAAGGGGG - Intergenic
1069448650 10:68497911-68497933 TTTTTATTTTTGAGGAAATGGGG + Intronic
1071547828 10:86541761-86541783 TTGTAGTTTTTGTAGAAATGAGG - Intergenic
1071616196 10:87078964-87078986 TTGTTGTTGTTGTAGAAATGAGG - Intronic
1071846690 10:89527908-89527930 TTATTGTTTTTGAGAAAATGTGG - Intronic
1071875129 10:89836859-89836881 TTGCTGTTCTTGAGAAACTGAGG - Intergenic
1072172643 10:92880960-92880982 TTGTTTTTCTTTAGGAATTCAGG + Intronic
1072961458 10:99933119-99933141 TTTTTGTTATTGTGGAGATGGGG - Intronic
1072964869 10:99963242-99963264 TTTTTGTTATTGTGGAGATGGGG + Intronic
1073348974 10:102805721-102805743 TTGTTGTTGTTGTTGAGATGAGG - Intronic
1073399981 10:103249428-103249450 TTGTTCTTATTGAAGAAATAAGG + Intergenic
1073667451 10:105549783-105549805 TTGTTGTTTTTCAGTAAATTGGG - Intergenic
1074958366 10:118415110-118415132 TTGTTTTTCTTAAGATAATGTGG - Intergenic
1074966625 10:118496455-118496477 TTTTTGTCATTGAGGAAGTGTGG - Intergenic
1075354521 10:121758966-121758988 TTGTTGTGTTTCAGGAAATAGGG - Intronic
1077850236 11:6069008-6069030 TTGTGGTACTTGAGGTATTGGGG - Intergenic
1078004868 11:7525052-7525074 TTGTTCTGCTTGTGGAAATGAGG + Intronic
1078533236 11:12153144-12153166 TTGTGGTACTTGGGGAACTGAGG - Intronic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079905656 11:26243819-26243841 GTGTTGTTTTTGAAAAAATGAGG + Intergenic
1080067907 11:28041434-28041456 TTGTTGAGCTCGAGGAAAAGAGG + Intronic
1080632855 11:34095067-34095089 TTGTTGTTGTTGTTGAGATGGGG + Intronic
1080900881 11:36489810-36489832 TAGTTGTTTTTGAGCAAGTGAGG + Exonic
1081102589 11:39023539-39023561 TAGTTGCTATTGGGGAAATGAGG + Intergenic
1081230262 11:40577677-40577699 TTGTTTTTCCTGAGGGACTGTGG - Intronic
1081436382 11:43032020-43032042 TTTTTGTTGTGGAGGAGATGTGG - Intergenic
1081822914 11:46017601-46017623 TTGGTTTTTTTGAGGAGATGAGG - Intronic
1082665017 11:55964784-55964806 TTGTGGTTTTAGAGGAAATGGGG - Intergenic
1082979250 11:59104855-59104877 TTGTTTTTCTAGTGGAGATGGGG - Intergenic
1083447274 11:62716788-62716810 TTGTTGTTGTTGAAGAATTATGG + Intronic
1083594024 11:63910542-63910564 TTTCTGTTCTTGAGAAATTGGGG + Exonic
1083763308 11:64830340-64830362 CTGTTTATCTTGAGGAAATGGGG + Intronic
1085205341 11:74728544-74728566 TTGTTGTTTTTTAAGAGATGAGG + Intronic
1085915787 11:80886027-80886049 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1086292205 11:85324542-85324564 TTACTTTTCTTTAGGAAATGGGG - Intronic
1087315760 11:96600365-96600387 TTGTTGTTGTTGTAGAAATGGGG - Intergenic
1087678735 11:101193647-101193669 CTAATGTTCTTGAGAAAATGTGG + Intergenic
1087907561 11:103716687-103716709 CTGTTGTACTTGAGGGACTGAGG - Intergenic
1088499923 11:110473158-110473180 TTGTATTTCTTGTGGAGATGGGG + Intergenic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1089460267 11:118648920-118648942 TTGTTGCACTGTAGGAAATGAGG - Intronic
1090069119 11:123528102-123528124 TTGTAGTTGTGGATGAAATGCGG + Intronic
1090723679 11:129501122-129501144 TTGTTGTTGTTTTGGAGATGGGG - Intergenic
1091074735 11:132604736-132604758 CTGTTGTTCCTGATTAAATGTGG - Intronic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1091739301 12:2948781-2948803 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1091787854 12:3253762-3253784 TGTTTGTTCTGGAGGGAATGTGG + Intronic
1091902962 12:4159924-4159946 TTTTTGTTTTTGTGGAGATGGGG - Intergenic
1093623020 12:21314546-21314568 TACTGGTTCATGAGGAAATGAGG + Exonic
1094180177 12:27584239-27584261 CTGGTGTTCCTGAGGTAATGAGG - Intronic
1095488228 12:42706446-42706468 TTTTTCTTCTTCAGCAAATGAGG + Intergenic
1095919883 12:47518382-47518404 TTGTAGTTCTTGTAGAGATGGGG + Intergenic
1096031409 12:48418911-48418933 TTTTTTTTCTGGAGAAAATGAGG - Intergenic
1096663636 12:53146681-53146703 TTTTTTTTCTTGTAGAAATGGGG - Intergenic
1098087213 12:66859248-66859270 TTGTTTTTTTTCAGAAAATGTGG - Intergenic
1098212292 12:68179279-68179301 GTTTTATTCTAGAGGAAATGGGG + Intergenic
1098931056 12:76414623-76414645 TTGTTGTTGTTGTTGAGATGAGG + Intronic
1099589658 12:84571198-84571220 TTATTGTTATCTAGGAAATGAGG + Intergenic
1099703286 12:86117158-86117180 TTATTGTTCTGAAGGAAATGAGG - Intronic
1099963796 12:89423189-89423211 TTGTTGTTGTTGTAGAAATGAGG + Intronic
1099979940 12:89586961-89586983 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1100598245 12:96089930-96089952 TTGTTGTTGTTGCAGAGATGAGG + Intergenic
1101120025 12:101569690-101569712 TTGTTGTTGTTGTTGAAATGGGG + Intronic
1101868130 12:108538321-108538343 TTGTTGTTGTTGAGGAAACCAGG - Intronic
1102020765 12:109680710-109680732 TTGTTGGTCTGGATTAAATGAGG - Intergenic
1103433622 12:120907664-120907686 AAGTGTTTCTTGAGGAAATGTGG + Intergenic
1104438886 12:128779012-128779034 TTCTTATTTTTGTGGAAATGGGG - Intergenic
1104627614 12:130371834-130371856 TTGTTTATTTTGAAGAAATGTGG + Exonic
1105003321 12:132705208-132705230 TTTTTTTTCTTGTAGAAATGAGG - Intergenic
1105051356 12:133054207-133054229 TTGTTGTTCTTGTTGAGATGGGG - Intronic
1105808617 13:23973972-23973994 TTGTTTTTCTTGTAGAAACGAGG + Intergenic
1106774142 13:32992107-32992129 TTCTTATTTTTGAGGAAATGGGG - Intergenic
1106805749 13:33305062-33305084 TTGTTGTTGTTGTAGAGATGAGG + Intronic
1107110349 13:36690967-36690989 TTGTTGTTGTTGTGGAAAACTGG - Intronic
1107471761 13:40697598-40697620 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1107775980 13:43841712-43841734 TTGTTGTTGTTGTTGAAGTGGGG + Intronic
1107963982 13:45582985-45583007 TTCTGGTTTTTGAGGAATTGTGG - Intronic
1108416831 13:50206155-50206177 TTGTTCTACTTGTGGACATGTGG - Intronic
1109018879 13:57059102-57059124 TTGTTGTTCTTGAAACATTGAGG - Intergenic
1109165157 13:59025409-59025431 TTGTATTTCTAGAAGAAATGGGG + Intergenic
1109323156 13:60834433-60834455 TTGTTGTGTTTGAGGATAAGAGG - Intergenic
1109356830 13:61240847-61240869 TTGTTTTTCTTGAAGTGATGGGG - Intergenic
1109429689 13:62215382-62215404 TTGTTCTACTTTAGGAAATCAGG - Intergenic
1110256929 13:73443279-73443301 TTGTTTTTCTAGTGGAGATGGGG - Intergenic
1110931075 13:81217369-81217391 TTGTAGTTTTTGAAGAAATGGGG + Intergenic
1111447201 13:88362607-88362629 TTGGGATTCTTGAGTAAATGTGG - Intergenic
1111551273 13:89816984-89817006 TTGTTGTTTTTGTGGAGATTGGG - Intergenic
1111831036 13:93329797-93329819 TTGTTGGGCTTAAGGTAATGGGG - Intronic
1111907035 13:94267089-94267111 TTGTTGTTGGTGAGAAAACGGGG - Intronic
1112306169 13:98276188-98276210 TTGATGTAATTGATGAAATGAGG + Intronic
1112794227 13:103037599-103037621 TTCTTATTCTTGTGGAAATGTGG - Intergenic
1113592946 13:111513450-111513472 TTGTTGTTGTTTAAGAGATGGGG + Intergenic
1113958183 13:114110617-114110639 TTGTTGCTGATGAGGAAACGGGG - Intronic
1114310409 14:21461578-21461600 TTTTTTTCCTTGAGGAAATGAGG + Intronic
1115128614 14:30026116-30026138 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1115688511 14:35821329-35821351 TTCTTGTTCTAAAGGAAATATGG - Intergenic
1116379097 14:44242253-44242275 TGGTTTTTCTTGGGGAGATGAGG - Intergenic
1117250010 14:53927441-53927463 TTGTTGTTGTTGTAAAAATGTGG + Intergenic
1118050501 14:62021291-62021313 TTGTTGTTCTGGTGTAAGTGTGG + Intronic
1119039380 14:71258879-71258901 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
1119812266 14:77532043-77532065 TTGTTGTTTTTAAGTAAAAGGGG - Intronic
1120358523 14:83464525-83464547 TTGTTTTAATTGAGGAAATAGGG - Intergenic
1120438644 14:84509103-84509125 TTGTAGTTTTTGTAGAAATGGGG - Intergenic
1120527723 14:85596509-85596531 TTGTTGTTGTTGTTTAAATGTGG + Intronic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1121293404 14:92795701-92795723 TTCTTGTTCTTGGGGAAAGTGGG - Intronic
1122911335 14:104829367-104829389 TTGTTGTTTTTAAAGAAATGAGG - Intergenic
1124426049 15:29564045-29564067 TTGTTGTCCATGATTAAATGAGG + Intronic
1124849213 15:33319748-33319770 TAGTTCTCCTGGAGGAAATGTGG - Intronic
1125816575 15:42590133-42590155 TTGTAGTTTTTGTAGAAATGTGG + Intronic
1126076310 15:44913676-44913698 TTGTTTTTAATGAGGAAATAAGG - Intergenic
1126082536 15:44979326-44979348 TTGTTTTTAATGAGGAAATAAGG + Intergenic
1127436026 15:58959080-58959102 TTGTAGTTTTTGTAGAAATGAGG + Intronic
1127503948 15:59580355-59580377 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1127539439 15:59922294-59922316 TTGTTGTTGTTGCTGAGATGGGG - Intergenic
1127835442 15:62787338-62787360 TTGTTGTGTTTGAGGCAGTGAGG + Intronic
1128934529 15:71733979-71734001 TTGTTGTTATTGCTGAAATGGGG + Intronic
1129466793 15:75728605-75728627 CTGTTGGTCTTGAGGAGGTGAGG + Intergenic
1129930608 15:79407499-79407521 TTGTTGATCTGGAGGCAATGAGG + Intronic
1130090563 15:80817420-80817442 TTGTTGTTTTTGTAGAGATGGGG - Intronic
1130454073 15:84087223-84087245 TTGTTGTTTTTGAAGAGATGGGG - Intergenic
1130860205 15:87879061-87879083 TTGTTCTACTTTGGGAAATGTGG + Intronic
1130929218 15:88410486-88410508 TTGTTGTTTTTGATAAAATTTGG + Intergenic
1132036803 15:98491959-98491981 GTGATGGTCATGAGGAAATGTGG - Intronic
1132211233 15:100024098-100024120 TTGTTGTTGTTGTTGAGATGGGG + Intronic
1132763331 16:1521847-1521869 TTTTTTTTCTTGTGGAGATGGGG - Intronic
1133527028 16:6615619-6615641 TTCTTTATTTTGAGGAAATGAGG - Intronic
1134158910 16:11868446-11868468 TGTTTGTTCTAAAGGAAATGTGG - Exonic
1134895440 16:17882257-17882279 TTTTTTTTCTTGAAGAGATGGGG + Intergenic
1135165046 16:20131648-20131670 TTTTTTTTCCTGTGGAAATGTGG - Intergenic
1135479191 16:22807320-22807342 TTGTTGTCCTTCAGGCAAAGGGG + Intergenic
1135813299 16:25609243-25609265 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1135966504 16:27040070-27040092 TTGTTGTTGTTGTTGAGATGGGG - Intergenic
1136322492 16:29496441-29496463 TTGTAGTTTTTGTGGAGATGGGG + Intronic
1137384263 16:48027043-48027065 GTGTTGTCCTGGAGGCAATGTGG + Intergenic
1139243417 16:65417565-65417587 TGGTTGTTCTTCAGGGAATTAGG + Intergenic
1139646751 16:68337058-68337080 TTGTATTTTTTGTGGAAATGGGG + Intronic
1139739412 16:69022529-69022551 TTGTATTTTTTGTGGAAATGGGG - Intronic
1140056438 16:71529973-71529995 TTGTATTTCTAGTGGAAATGGGG - Intronic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1143574423 17:7782125-7782147 TTGTTGATCTTAAGGCAGTGAGG + Intronic
1144472321 17:15555922-15555944 TTTTTGTTGTTGTTGAAATGGGG + Intronic
1146239085 17:31198610-31198632 TTGTTGTTGTTGAGGGGGTGGGG + Intronic
1146701028 17:34960581-34960603 TTTCTGTTCTTAAGGAGATGTGG - Intronic
1146753295 17:35401996-35402018 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1147997173 17:44366661-44366683 TTGCTGTTCTCTGGGAAATGGGG - Intergenic
1148282454 17:46359491-46359513 TTGTATTTTTTGTGGAAATGAGG + Intronic
1148304672 17:46577416-46577438 TTGTATTTTTTGTGGAAATGAGG + Intronic
1148524644 17:48319667-48319689 TTGTATTTTTTGAAGAAATGGGG - Intronic
1149609982 17:57953146-57953168 AGCTTGTTCTTGGGGAAATGGGG - Intronic
1149613555 17:57977297-57977319 TTGTTGTTTTTGTAGAGATGGGG + Intronic
1149790721 17:59474636-59474658 TTGTATTTCTTGAGGAGATGGGG + Intergenic
1149808056 17:59637960-59637982 TTGTTTTTGTTGGGGAAGTGAGG - Intronic
1149862676 17:60132067-60132089 TTTTTGTTTTTGAGGAGATGAGG + Intergenic
1149914417 17:60595860-60595882 TTGTTGTTTTTTAAGATATGAGG + Intergenic
1150685068 17:67313991-67314013 TTGTTGTTGTTTTGGAGATGGGG - Intergenic
1150830387 17:68512895-68512917 CCGTTGTCCTTCAGGAAATGGGG - Intronic
1152593476 17:81225347-81225369 TTGTTGTTGTTGCAGAGATGGGG + Intergenic
1152598064 17:81247652-81247674 TTTTTGTTTTTGTGGAGATGGGG - Intronic
1152667996 17:81582573-81582595 TTTTTGTTGTTGTAGAAATGAGG + Intronic
1154063245 18:11083286-11083308 TTGTGGTTCTTTATGAAAAGAGG + Intronic
1154989248 18:21584813-21584835 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1155737373 18:29240343-29240365 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1155953505 18:31937355-31937377 TTGTAGTTTTTGTAGAAATGGGG - Intronic
1156333699 18:36149712-36149734 TTGTTTTTCTTGTTGATATGGGG - Intronic
1157526632 18:48387997-48388019 TTGTAGTTTTTGTAGAAATGAGG + Intronic
1158532177 18:58273338-58273360 TTGTTTTTCCTGTGAAAATGTGG - Intronic
1158547193 18:58406337-58406359 TTATTGTTCTTCAGGATGTGTGG - Intergenic
1158642585 18:59216367-59216389 TTGTATTTTTTGTGGAAATGGGG - Intergenic
1158700214 18:59738518-59738540 TTGTTGTTGTTGTAGAGATGAGG + Intergenic
1158993803 18:62896604-62896626 TTGTTGTTTTTAAAGAGATGGGG + Intronic
1159203279 18:65217139-65217161 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1159606005 18:70476055-70476077 TTTTGGTTCTTGGGGACATGTGG + Intergenic
1162406446 19:10477252-10477274 TTGTTATTTTTGTGGAGATGAGG - Intergenic
1162521808 19:11185245-11185267 TTGTTGTTGTTGTGGAGATGGGG - Intronic
1162578284 19:11512170-11512192 TTGTATTTCTTGTAGAAATGGGG - Intronic
1163342440 19:16718025-16718047 TTGTTGTTGTTGTAGAGATGAGG + Intergenic
1164811365 19:31159170-31159192 TTGTATTTCTTGTGGAGATGGGG + Intergenic
1165639567 19:37372643-37372665 TTGTACTTTTTGAGGAGATGGGG + Intronic
1165988939 19:39794884-39794906 TTTTTTTTCTTCAGGAAATGAGG + Intergenic
1166037519 19:40179843-40179865 TTGTTGTTGTTGTGGAGACGGGG - Intergenic
1167088435 19:47326693-47326715 TTGTTGTTTTTGAAAAATTGTGG + Intergenic
1167192304 19:47999827-47999849 TTTTTTTTTTTTAGGAAATGGGG + Intronic
1167570290 19:50282897-50282919 TTGATGTTTTTGATCAAATGTGG + Intronic
1168087558 19:54059644-54059666 TTGTTGTTGTTGTAGAGATGGGG + Intronic
925045806 2:772393-772415 TTGCTGTCCTTTGGGAAATGGGG - Intergenic
926011357 2:9410747-9410769 TTGTTTTTTTTGTAGAAATGAGG + Intronic
926449330 2:12983238-12983260 ATGTTGTTCTTGTGATAATGAGG + Intergenic
926518830 2:13883911-13883933 TTTTTCTACTTGAGGAAAGGAGG + Intergenic
926658240 2:15433924-15433946 TTCTTTTTCTTGAAGAGATGAGG - Intronic
926774788 2:16411237-16411259 ATGATGTTCTTGAGTAGATGGGG - Intergenic
927488832 2:23507087-23507109 ATGTTGAGCCTGAGGAAATGCGG - Exonic
927582426 2:24264961-24264983 TTGTTGTTGTTGTAGAGATGAGG + Intronic
927983482 2:27390545-27390567 TTGTTGTTGTTGTTGAGATGAGG - Intronic
930948726 2:57110395-57110417 TTGTTGTGCGTGAGGGAATGGGG + Intergenic
931189293 2:59983989-59984011 GTGTTGTGCATGTGGAAATGAGG - Intergenic
931297565 2:60943951-60943973 TTGTTGTTGTTGTTGAGATGGGG - Intronic
931697682 2:64883830-64883852 TTCTTATTTTTGAGGAGATGGGG - Intergenic
931745572 2:65289020-65289042 TTGTTTTTTTTGTGGAAATGGGG + Intergenic
932045436 2:68344171-68344193 TTGTTTATCCTGTGGAAATGTGG + Intergenic
932098699 2:68876458-68876480 TTTTTTTTTTTGTGGAAATGGGG - Intergenic
933557937 2:83853999-83854021 TTGTTGTTTTTGAACAAATTTGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934876832 2:97929446-97929468 TTGTTGGTCTTTTGGAAATCAGG + Intronic
934965807 2:98720908-98720930 TTATTGTTCTTCAGTAAATTTGG - Intronic
935760719 2:106318113-106318135 TTATTGTTGTTGAAGAAATTGGG + Intergenic
935968534 2:108507217-108507239 TTGTTTTTTTTGTGGAGATGCGG - Intronic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
936719090 2:115228118-115228140 TTGTTGTTGTTGTTGACATGGGG + Intronic
937295070 2:120805180-120805202 CTGTTGTGCTTGGGGAAATGGGG - Intronic
938029534 2:127980889-127980911 TTGTTGTTGTTGTTGAGATGGGG - Intronic
938050851 2:128169469-128169491 GTTTAGTTCTTCAGGAAATGTGG + Intronic
938272064 2:129981171-129981193 TTGTTTGTTTTGAGGAAGTGGGG - Exonic
938443945 2:131362642-131362664 TTGTTTGTTTTGAGGAAGTGGGG + Intergenic
938612699 2:132965181-132965203 TTGTAGTTCTTTATGAAATCAGG + Intronic
938821400 2:134963753-134963775 TTGTATTTTTTGTGGAAATGGGG - Intergenic
939163357 2:138614538-138614560 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
939173181 2:138719700-138719722 TTGTGGTTTTTGAGGGGATGAGG - Intronic
939635903 2:144582355-144582377 TTCCTGTTCGTGACGAAATGAGG - Intergenic
940263519 2:151811125-151811147 TTGGTGGTCATAAGGAAATGAGG + Intronic
940624084 2:156150435-156150457 TTGTAGTTTTTGTAGAAATGGGG - Intergenic
940861566 2:158775374-158775396 TTGTTTTTCTTATGGAGATGGGG - Intergenic
940993493 2:160121609-160121631 TTGTAGTTTTTGTAGAAATGGGG - Intronic
941030469 2:160505514-160505536 ATGGGGTTATTGAGGAAATGAGG - Intergenic
941364652 2:164595432-164595454 TTGTTTTTCTTGAGGACATTAGG + Intronic
941944592 2:171080879-171080901 TTGTGTTTCTTGTAGAAATGGGG + Intronic
942001529 2:171652862-171652884 TTGTTCTTCTTGAGGGGAGGAGG - Intergenic
942006244 2:171702882-171702904 TTTTTGTTTTTGTAGAAATGGGG + Intronic
942319188 2:174721296-174721318 TTGGTGTCCTTGGGGACATGGGG - Intergenic
942379296 2:175371589-175371611 TTGCTTTTATTGAGGGAATGTGG + Intergenic
942480366 2:176381316-176381338 TTGTGGTACTTGAGGCACTGTGG + Intergenic
942533709 2:176940556-176940578 CTGTTGTTTTTGGAGAAATGAGG - Intergenic
943923864 2:193745314-193745336 TTGTTGTTGTTGAGGATTTTTGG - Intergenic
944563165 2:200961895-200961917 TAGTTGTTCTTGGGGATGTGGGG + Intronic
944812581 2:203342346-203342368 TTGTTTTTCTTGATGTTATGTGG + Intronic
945898366 2:215510576-215510598 TTGATATTTTTGAAGAAATGAGG + Intergenic
946129683 2:217596691-217596713 TTCTTGATCTTGAGGAACTGAGG - Intronic
946850793 2:223904642-223904664 TTGTTCATCTTGGTGAAATGTGG - Intronic
947620154 2:231584846-231584868 TTGTTGTTGTTGGAGAGATGGGG + Intergenic
948285696 2:236783422-236783444 TTTTTTTTCTTTCGGAAATGTGG + Intergenic
948357433 2:237390713-237390735 TTGTTTTTCTTAATGAAAGGAGG - Intronic
948432532 2:237929118-237929140 TTGTTGTTTTTGCTGAGATGGGG + Intergenic
949011587 2:241682613-241682635 TTGTATTTTTTGAGGAAATGTGG - Intronic
1168801312 20:645195-645217 TTGTTGTTTTAGTAGAAATGGGG - Intergenic
1169105455 20:2990544-2990566 TTGTTGTTGTTGTAGAGATGGGG - Intronic
1169747336 20:8955767-8955789 TTGTTGTTGTTGTAGAGATGAGG - Intronic
1169953794 20:11078808-11078830 TTTTTTTTATTGTGGAAATGTGG + Intergenic
1169986603 20:11452056-11452078 TTGTTGTTTTGGGGGAAATTTGG + Intergenic
1170051304 20:12148598-12148620 TTTTTGTTCTTGGAGCAATGTGG + Intergenic
1170059371 20:12243537-12243559 TTATTCTTCTTGGGGAAGTGGGG - Intergenic
1170138340 20:13100555-13100577 TTGTTATTGTTTAAGAAATGAGG - Intronic
1170791338 20:19511912-19511934 TTGTTTTTCTTGAAGAACAGTGG + Intronic
1170971471 20:21121033-21121055 TTGCTGTTCTTGTGGTAGTGAGG - Intergenic
1171378922 20:24718069-24718091 TTGTTTTTCTTCAGGTAATTTGG + Intergenic
1171813940 20:29766100-29766122 TTATTGCTTTTGAGGACATGGGG + Intergenic
1172142988 20:32736865-32736887 TTGTAATTTTTGAAGAAATGGGG - Intronic
1172264830 20:33601978-33602000 TTGTTGTTTTTGGAGAGATGAGG + Intronic
1172267089 20:33625773-33625795 TTGTTGTTGTTGTAGAGATGAGG - Intronic
1172953465 20:38738043-38738065 TTTTTATTTTTGTGGAAATGGGG + Intergenic
1174094587 20:48078205-48078227 TTCCTGTTCTTGAGGATGTGTGG + Intergenic
1174241786 20:49142049-49142071 TTGTTGTTCTTGTTGAGATGAGG - Intronic
1174421422 20:50401425-50401447 TTGTTGCTCTTCAGGAATCGAGG - Intergenic
1174595023 20:51677104-51677126 TTGTTTTTTTTGTAGAAATGAGG + Intronic
1174856642 20:54051742-54051764 TTGTTGTTGTTGTTGAGATGAGG + Intronic
1176049215 20:63107828-63107850 TTGTTTTACTTGAGGGAAGGTGG + Intergenic
1177373048 21:20231397-20231419 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1178410104 21:32356446-32356468 TTCTTTTTATTTAGGAAATGAGG - Intronic
1178616621 21:34139748-34139770 TTGTAGTTTTTGTGGAGATGAGG + Intronic
1180317391 22:11286722-11286744 TTATTGCTTTTGAGGACATGGGG + Intergenic
1180579823 22:16823053-16823075 TTGTGTTTTTTGAGGAGATGGGG + Intergenic
1181537675 22:23555069-23555091 TTTTTGTTCGTGATGAAATGGGG - Intergenic
1181909479 22:26227264-26227286 TTTTTATGCTTGAGGAAATTGGG - Intronic
1182176574 22:28296145-28296167 TTTTTTTTCTTTTGGAAATGTGG - Intronic
1182508345 22:30801799-30801821 TTTTTGTTGTTGTTGAAATGGGG - Intronic
1182513474 22:30837076-30837098 TTGTTGTTGTTGTAGAGATGGGG - Intronic
949253643 3:2019083-2019105 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
950954281 3:17034848-17034870 TTGGTGATCTTGAGTAACTGTGG - Intronic
951174163 3:19579683-19579705 TTGTTTTTCTGGAAGAATTGAGG + Intergenic
951433392 3:22634211-22634233 TTTTTTTTCTTGAGAAATTGTGG - Intergenic
952035286 3:29193794-29193816 TTGTTGTTTTTGTGGAGATAAGG + Intergenic
952079616 3:29742218-29742240 TTATTTTTCTTTAGGAACTGAGG + Intronic
952326396 3:32324206-32324228 TTGTTGTTCTTAAATAAATGGGG - Intronic
952743177 3:36753849-36753871 TTGTTGTTGTTAAAGAAATAGGG + Intergenic
953187143 3:40648649-40648671 ATGTTGTTGTTGAGGTAGTGTGG + Intergenic
954060866 3:48065944-48065966 TTGTTGTTTTTGTAGAGATGGGG - Intronic
956122827 3:65983087-65983109 TTTTTGTTTTTGTTGAAATGGGG + Intronic
956518334 3:70076021-70076043 TTGCTATTCTTGAGCAAATTCGG + Intergenic
957627050 3:82666671-82666693 TTGTTGTGTCTCAGGAAATGAGG + Intergenic
959079006 3:101780092-101780114 TTCTTTATCTTTAGGAAATGTGG - Intronic
959165311 3:102769625-102769647 TTGTTGTGTTTTAGGAAATATGG + Intergenic
960455378 3:117864581-117864603 TTGTTGTTATGGAAGGAATGTGG - Intergenic
960583968 3:119303799-119303821 TTGTTGTTGTTGTTGAGATGGGG + Intronic
961613703 3:128161938-128161960 TTGGTGTCCTTGAGGAATTTGGG + Intronic
961949725 3:130736974-130736996 GTGTTGTCCTTTTGGAAATGTGG - Intronic
962325580 3:134429266-134429288 TTGTTATTGATGAGGAAATGAGG - Intergenic
963370646 3:144395537-144395559 TTGTTATTTTTGTAGAAATGGGG + Intergenic
963523696 3:146389251-146389273 TTATTTTTCTTGAGAAAAAGTGG + Intergenic
963677264 3:148327984-148328006 TTGTTGTTGTTGAAGAAACTAGG + Intergenic
964137297 3:153359099-153359121 TTGTATTTCTTGTAGAAATGAGG + Intergenic
964577234 3:158185880-158185902 TCATTGTTCTAAAGGAAATGAGG - Intronic
965058526 3:163753204-163753226 TTGTTCTACTGGAGGAAATGTGG - Intergenic
965689286 3:171338241-171338263 TTGTTGTTGTTACTGAAATGAGG - Intronic
966185841 3:177226323-177226345 TTGGTGTTCTTGAGTACATATGG + Intergenic
966625280 3:182009068-182009090 TTGTTGTTGTTGTTGAAATATGG + Intergenic
966846183 3:184132065-184132087 TTGTAGTTTTTGTAGAAATGGGG - Intergenic
967260363 3:187635674-187635696 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
968030241 3:195477529-195477551 TTGTTTTTCTTGTAGAGATGGGG - Intergenic
968836671 4:2969847-2969869 TTGTGGTTTTTGTGGAGATGGGG + Intronic
970331028 4:14984006-14984028 TTGTTTTTTGTGAGGATATGTGG - Intergenic
970935437 4:21564894-21564916 GTGTTGTCCTTGTGGTAATGAGG - Intronic
971058212 4:22937358-22937380 TTTTTTTTTTTGAGGAAAGGAGG + Intergenic
971259989 4:25047523-25047545 TTTTTTTTTTTGTGGAAATGAGG + Intergenic
971797849 4:31251750-31251772 TTGTTGTTATTTAGGAGCTGGGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972444816 4:39133558-39133580 TTTTTTTTTTTTAGGAAATGGGG - Intergenic
972688517 4:41373866-41373888 TTGCTGTTCTTGAGATAGTGAGG + Intronic
972932421 4:44089571-44089593 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
975138419 4:70896761-70896783 TTTTTGTTCTTGTGGAGATAGGG + Intergenic
975333200 4:73143296-73143318 TTGTTGTTTTCGTAGAAATGGGG + Intronic
976938696 4:90672809-90672831 TTGTTGTGTTTCAGGAAATAGGG + Intronic
976985922 4:91297822-91297844 TTGGGGTACTTGAGGAAAAGTGG + Intronic
977302206 4:95280680-95280702 TTGTTGTTGTTGTTGAGATGGGG - Intronic
977572960 4:98648783-98648805 TTGTTTTTCTTGGGAAGATGTGG - Intronic
978644330 4:110911228-110911250 TTGTTTTTCTTGAAGTAATAGGG + Intergenic
979111862 4:116768576-116768598 TTGTTGTTATTTAGGAGGTGTGG + Intergenic
979557882 4:122071431-122071453 TTTTTGTAGTTAAGGAAATGAGG + Intergenic
979622026 4:122808869-122808891 TTGGTATTCTTGTGGAGATGTGG - Intergenic
979762205 4:124420163-124420185 TTGCTGGCCTTGAGAAAATGGGG - Intergenic
980114850 4:128669512-128669534 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
980124304 4:128759048-128759070 ATGTTTTTCTTGAGAAATTGTGG + Intergenic
980529475 4:134033333-134033355 TTGTTGTTTCTTAGGGAATGGGG - Intergenic
981226383 4:142299332-142299354 TTGTAGTTTTTGTAGAAATGGGG + Intronic
981330216 4:143499710-143499732 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
981766037 4:148251129-148251151 TTGTTCTTTTTGTAGAAATGGGG + Intronic
982357040 4:154482384-154482406 TTTTGGTTCTTGAGCAAAAGTGG - Intronic
982941052 4:161555792-161555814 TTGTTGTTTTTGAAAATATGAGG + Intronic
983124312 4:163931518-163931540 TGGTTGTCTTTGAGAAAATGGGG + Intronic
983787778 4:171755916-171755938 TTGTTAATCTTGAGGGAAAGTGG - Intergenic
984210647 4:176843288-176843310 TTGTTTTTCCTGATGCAATGTGG + Intergenic
984567980 4:181354277-181354299 TTGCAGATCTAGAGGAAATGAGG + Intergenic
984807112 4:183761694-183761716 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
984869050 4:184310836-184310858 TTGTTATTGTTGAGGGAATATGG - Intergenic
986234432 5:5894000-5894022 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
987293943 5:16533721-16533743 TTTGTGTTCTGGAGGCAATGTGG - Intronic
987525293 5:19041752-19041774 TTGTTGTTCTTATGGAAGTTAGG + Intergenic
988738037 5:34042434-34042456 TTGTTGTTCTTAAGAGAATTGGG - Intronic
989781026 5:45264586-45264608 TTTTTGTTCTTTGGGAAATTAGG - Intronic
989988233 5:50728557-50728579 GTGTAGTTCTTTAGGAACTGAGG - Intronic
990399732 5:55426404-55426426 TTGTTTTCCTTAAAGAAATGGGG + Intronic
991187012 5:63820808-63820830 TTGTAGTCCTTGAGCAAGTGTGG - Intergenic
991521251 5:67499567-67499589 TTGTTGTTATTGCAGAAATATGG - Intergenic
991629784 5:68645033-68645055 TTGTTGTTGTTGGGGAAAGTGGG - Intergenic
991770559 5:70037193-70037215 TTGTGCTTTTTGAGGAGATGGGG - Intronic
991849854 5:70912611-70912633 TTGTGCTTTTTGAGGAGATGGGG - Intronic
991925310 5:71699246-71699268 TTGTTGTTTTTTAAGAGATGGGG - Intergenic
992238860 5:74743958-74743980 TTTTTGTTATTGAGTTAATGAGG - Intronic
992341768 5:75831789-75831811 TTGTTGTGCTGCAGGAACTGGGG + Intergenic
992653383 5:78884171-78884193 TTGTTGGCCTTCTGGAAATGTGG + Intronic
993554161 5:89314945-89314967 TTGTTGTGCATGAGAAAATCTGG + Intergenic
993661430 5:90641173-90641195 TAATTGTTCTTGAGGTTATGTGG - Intronic
994597402 5:101857549-101857571 GTGTGGATCTTGAGTAAATGGGG - Intergenic
994859934 5:105178383-105178405 TATTTGTTCTTGAGGAAAGCAGG - Intergenic
995336883 5:111009560-111009582 TTGTGGTTCATGATGATATGTGG + Intergenic
995538635 5:113162669-113162691 TTGTTGTTGTTGTAGAGATGGGG + Intronic
995655605 5:114422753-114422775 CTGTTTTTTTTGAGCAAATGTGG + Intronic
997276058 5:132591811-132591833 TTTTTGTTCTTGATATAATGTGG + Intronic
997951591 5:138246714-138246736 CTGTTGTTATTTAGGATATGGGG + Intergenic
997986163 5:138503070-138503092 TTGTTGTTTTTGTAGAGATGAGG - Intergenic
998827852 5:146122651-146122673 GTTTTGTTCTTGGTGAAATGAGG - Intronic
999218928 5:149959218-149959240 TTTTTTTTGGTGAGGAAATGAGG - Intergenic
999989539 5:157036896-157036918 TTGTTTTTTTTTAAGAAATGGGG + Intronic
1001082200 5:168675693-168675715 TTGTTGTTTTTTAAGAAATAGGG - Intronic
1001282098 5:170393537-170393559 TTTTTGTAGTTGAGGAAATCTGG - Intronic
1001324976 5:170716909-170716931 TTGTATTTTTTGAGTAAATGAGG - Intronic
1001614536 5:173031970-173031992 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1002957418 6:1880273-1880295 TTTTTTTTTTTGTGGAAATGAGG - Intronic
1003491959 6:6630624-6630646 TTGTTGTTCTTGAGGATTGAGGG - Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004257891 6:14081643-14081665 TTGTTGTTGTTGTAGAAACGAGG - Intergenic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1004410209 6:15374548-15374570 TTGATGATCTTGCTGAAATGTGG + Intronic
1004467794 6:15902090-15902112 TTTTAGTTCTTGGAGAAATGGGG - Intergenic
1005481703 6:26260948-26260970 TTTTTTTTCTTAAGGAAATGAGG + Intergenic
1005588735 6:27302655-27302677 TTGTTGTTGTTGAGGAAATGGGG - Intronic
1006285221 6:33087954-33087976 TTATAGTTTTTGAGGAAATGAGG - Intergenic
1006868827 6:37231800-37231822 TTTTTTTTTTTCAGGAAATGGGG + Intronic
1008096726 6:47346601-47346623 TTTTTATTCTTCAGGCAATGAGG - Intergenic
1008358356 6:50584270-50584292 TTTTTCTTCTTAAGGATATGTGG - Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009799152 6:68511326-68511348 TTGTTGTTCTTTCTGTAATGTGG + Intergenic
1009919902 6:70044592-70044614 TTGTTGTTCCTTAGGAAATAGGG + Intronic
1010004920 6:70985405-70985427 TTGCTGTTCTTGTGATAATGAGG - Intergenic
1010545327 6:77148299-77148321 TTATTTTTATTGTGGAAATGGGG + Intergenic
1010915278 6:81609284-81609306 GTGGTGGTCTTGAAGAAATGTGG + Intronic
1010964332 6:82186197-82186219 TTGTTGTTTCTTAGGAAATAGGG - Intronic
1012351658 6:98259169-98259191 TTTTTGTTTTTGAGGAATGGGGG + Intergenic
1012456008 6:99406073-99406095 GTGCTCTTCTTGAGGAACTGGGG + Exonic
1012515646 6:100055743-100055765 TTGTATTTTTTGAAGAAATGTGG + Intergenic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1013657534 6:112261131-112261153 TTTTTGTTCTTGTAGATATGGGG - Intergenic
1013688367 6:112611361-112611383 TTGTTCTTGTTGATGAAATGGGG - Intergenic
1013733587 6:113200259-113200281 ATGTTTTCCTTGAGCAAATGAGG - Intergenic
1013781052 6:113729042-113729064 TCTTTGTTCTTTAGGAATTGTGG + Intergenic
1013848610 6:114485815-114485837 TTTTTGTTATTTTGGAAATGGGG + Intergenic
1014581243 6:123140042-123140064 TTATTTTTCATGAGCAAATGTGG + Intergenic
1015242709 6:131043547-131043569 TTGTTGTTGTTGAAGAAATTGGG - Intronic
1015553731 6:134439482-134439504 TTGTTGTTCAAGGGGAAAAGTGG - Intergenic
1017189684 6:151639220-151639242 TTGTTGTTGTTGTAGAGATGAGG + Intergenic
1017827800 6:158095319-158095341 TCTTTGTCCTTTAGGAAATGGGG - Intronic
1017930200 6:158945884-158945906 TTGTATTTTTTGTGGAAATGGGG + Intergenic
1020090883 7:5339967-5339989 TTGTTGTGCTTTAGGGAATAGGG - Intronic
1020644018 7:10791686-10791708 TTGTTTTTCTTGTGTAGATGGGG - Intergenic
1020815848 7:12904618-12904640 TTGTTTTTCATGATGTAATGAGG - Intergenic
1021360838 7:19709788-19709810 GTGTTGTCCTAGAGAAAATGGGG - Intergenic
1022545440 7:31183534-31183556 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1023149936 7:37192623-37192645 TTGTAGTTTTTGTGGAGATGGGG - Intronic
1023378710 7:39584844-39584866 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1024897988 7:54282151-54282173 TTGTTGTTGTTGTAGAGATGAGG + Intergenic
1025922735 7:65928732-65928754 TTGCTTCTCTTGAGTAAATGGGG + Intronic
1026060797 7:67024199-67024221 TTGTTGTTTTTGTAGAGATGAGG + Intronic
1026110712 7:67456821-67456843 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1026682467 7:72477592-72477614 TTGTTGTTTTTGTAGAAACGGGG + Intergenic
1026717571 7:72803198-72803220 TTGTTGTTTTTGTAGAGATGAGG - Intronic
1027396937 7:77766355-77766377 TTGTATTTTTTGTGGAAATGGGG + Intronic
1027729904 7:81858372-81858394 TTCTAATTCTTAAGGAAATGAGG - Intergenic
1027834905 7:83228324-83228346 TTTTTATTTTTGTGGAAATGGGG - Intergenic
1027889289 7:83950336-83950358 TTGTAGTTTTTGTAGAAATGGGG - Intergenic
1028122828 7:87076062-87076084 TTGTTGTTGTTAACAAAATGAGG + Intergenic
1028178180 7:87681828-87681850 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1028560166 7:92166494-92166516 TTTTTGTTCTTGAGTAAATTTGG - Intronic
1029627291 7:101727979-101728001 TTGTTGTTGTTGTGGAGATGGGG + Intergenic
1029723078 7:102383042-102383064 TTATTGTTTTTGTAGAAATGGGG - Intronic
1029821417 7:103150883-103150905 TTTTTTTTTTTGGGGAAATGGGG - Intergenic
1030014873 7:105208947-105208969 TTGTTGTTTTTGTAGAGATGAGG - Intronic
1030332414 7:108285207-108285229 TTGTTGTTCTTGCAGGCATGTGG - Intronic
1030393419 7:108955431-108955453 TTGTTGTTGTTGTGGAGATGGGG + Intergenic
1031291586 7:119944195-119944217 TTGTTGTTCTTGTGATAGTGAGG - Intergenic
1031522387 7:122782433-122782455 TTGTTGTTGTTGTAGAGATGGGG - Intronic
1031687081 7:124744313-124744335 TGGTGGTGCTTCAGGAAATGGGG - Intergenic
1032556333 7:132839242-132839264 TTGTTGTTCTTGTGGTCACGTGG - Intronic
1032563929 7:132921052-132921074 TGATTTATCTTGAGGAAATGGGG - Intronic
1033199350 7:139355199-139355221 TTGTTGGTCAAGAGAAAATGAGG + Intronic
1033369895 7:140698061-140698083 TTGTTGTTATTAAGGAACTGAGG + Intronic
1033955169 7:146838488-146838510 TTGTATTTTTAGAGGAAATGGGG + Intronic
1034770159 7:153765924-153765946 TTGGTGTTCTTGTTAAAATGTGG + Intergenic
1035186680 7:157131755-157131777 TTGTATTTTTTGTGGAAATGGGG - Intergenic
1035334212 7:158115169-158115191 TTGTTGTTATTTTGGATATGGGG - Intronic
1037341619 8:17851805-17851827 TTATTGTTTTTGTAGAAATGGGG + Intergenic
1037798058 8:22013361-22013383 TTGTTGTTGTTGTGGAAATGAGG - Intergenic
1038089406 8:24236470-24236492 TGGTTTTTCTCGAGGAAGTGTGG + Intergenic
1038272305 8:26085191-26085213 TTGATGTTCTTGAGGACTAGTGG - Intergenic
1038446885 8:27610728-27610750 CTTTTATTCCTGAGGAAATGGGG + Intronic
1039002765 8:32999751-32999773 TTTTTGTTCTTGTGGATAAGAGG - Intergenic
1039814487 8:41080959-41080981 TTTTTGTTTTTGAGGAGATAGGG - Intergenic
1040040280 8:42909635-42909657 TTGTTGTTGTTGTAGAGATGGGG + Intronic
1041407195 8:57513003-57513025 TTGGTGTTCTGGAGGGAATGAGG + Intergenic
1041909644 8:63075144-63075166 TTGTTGTTGTTGTGGACATAGGG - Intronic
1042123941 8:65518142-65518164 TTGTTGTTGTTGTTGAAATCTGG - Intergenic
1042166971 8:65955273-65955295 TTGTATTTCTTGTAGAAATGGGG - Intergenic
1043709777 8:83402494-83402516 TTCTTATTAATGAGGAAATGAGG - Intergenic
1043846915 8:85174166-85174188 TTGTAGTTTTTGTAGAAATGGGG + Intergenic
1044043850 8:87404413-87404435 TTGTTATTCTTGACAAAATTGGG + Intronic
1044915469 8:97108857-97108879 TTGAAGTCCTTGAGAAAATGTGG - Intronic
1045595980 8:103657049-103657071 TTGTTTCTCTTGAGGGAAGGTGG - Intronic
1045627167 8:104067562-104067584 TTGTTGTTGTTGTGGAGACGGGG + Intronic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047351315 8:124077471-124077493 TTATTGCTCCTGAGGAAATGAGG + Intronic
1048026598 8:130592804-130592826 GTGTAGTCCTTGAAGAAATGTGG - Intergenic
1048356563 8:133658511-133658533 TTTCTGTTTTTGAGGAAATGAGG + Intergenic
1048712925 8:137232355-137232377 TTGATAAGCTTGAGGAAATGGGG + Intergenic
1048719733 8:137310015-137310037 TGAGTTTTCTTGAGGAAATGGGG + Intergenic
1049041614 8:140116182-140116204 TTTTTATTCTTAAGGCAATGAGG + Intronic
1049739138 8:144227470-144227492 TTGTATTTTTTGTGGAAATGGGG - Intronic
1050202309 9:3158435-3158457 TTGGTTATCTTGAGGAAAAGTGG - Intergenic
1050650862 9:7775258-7775280 TTGTTGTTTTTGGGGAAGGGGGG - Intergenic
1051210939 9:14742572-14742594 TTGCTGTCCTTGTGGAAATATGG + Intronic
1051249840 9:15148456-15148478 TTGTTGTTGTTGTAGAGATGGGG - Intergenic
1051644044 9:19250397-19250419 TTGTAGTTTTTGTAGAAATGGGG + Intronic
1052444354 9:28541111-28541133 TTGCTGATATTGATGAAATGTGG + Intronic
1053194295 9:36103687-36103709 TTGTTGGCCTTGAGAAAATATGG - Intronic
1054754974 9:68948456-68948478 CTGTTGTTGTTGTAGAAATGAGG - Intronic
1055206806 9:73740965-73740987 TTTTTGTTCCTGGGGAGATGAGG + Intergenic
1055637625 9:78294390-78294412 TTGTTGAACTGGAGGAAATTTGG + Intergenic
1055796634 9:79981575-79981597 TTCTTGTTAGCGAGGAAATGAGG + Intergenic
1055968220 9:81885932-81885954 TTGTTGTGCTTGAGTAATTTAGG + Intergenic
1056170020 9:83975976-83975998 CTGAAATTCTTGAGGAAATGGGG + Intronic
1057030843 9:91774128-91774150 TTTTTCTTCCTAAGGAAATGTGG + Intronic
1057130942 9:92654342-92654364 TAGTTTTTCTTGTGGAAATGGGG - Intronic
1057515548 9:95717399-95717421 TTCTTGTTCTTCATGATATGGGG - Intergenic
1057691046 9:97286379-97286401 TTGTTGTTCTTGAGGTTAGGGGG + Intergenic
1059050632 9:110920948-110920970 TTGTTGTTGTTGTTGAGATGGGG - Intronic
1059289186 9:113207288-113207310 TTGTTCATCTTCAGGAAATCAGG - Exonic
1059866146 9:118516040-118516062 TGGTTGTTTTTGAGGCCATGAGG + Intergenic
1061244305 9:129393494-129393516 TTTTTGTTCGTGATAAAATGGGG + Intergenic
1061285722 9:129621347-129621369 TTGTTGTTGTTAAAGAGATGGGG + Intronic
1061449885 9:130662205-130662227 TTGGTGTCCTGGAGGAACTGAGG + Intergenic
1061770358 9:132915005-132915027 TTGTTGTTGTTGTAGAGATGGGG - Intronic
1061810064 9:133157109-133157131 TTGTTGTTTTTGTAGAGATGAGG - Intronic
1203365627 Un_KI270442v1:252437-252459 TTATTGCTTTTGAGGACATGGGG + Intergenic
1186293537 X:8124536-8124558 GTGTTGTACTTGAGAATATGAGG - Intergenic
1186639440 X:11439834-11439856 ATATTGTTCTAGAAGAAATGGGG - Intronic
1186851361 X:13583333-13583355 GGGGTGTTCTGGAGGAAATGGGG - Intronic
1187267178 X:17746264-17746286 ATGTTGCTATTCAGGAAATGTGG - Intronic
1187284125 X:17886640-17886662 TTGTTGTTCATCAGGACCTGAGG - Intergenic
1187754802 X:22511210-22511232 TTGTTGTTGTTAAGCAAATTTGG - Intergenic
1188625080 X:32274225-32274247 TTCTTGTTCTTCAGTATATGAGG - Intronic
1189576855 X:42363071-42363093 TTGTTTTTCTTTATTAAATGTGG + Intergenic
1190746546 X:53326536-53326558 TTGTTGTTCATCAGAAACTGTGG + Intergenic
1190756048 X:53402993-53403015 TTGTTGTTATTGTAGAGATGGGG - Intronic
1194110832 X:89832354-89832376 TTCATTTTCTTGAGGAAATGTGG + Intergenic
1194477164 X:94372395-94372417 TTGTTGTTTTTGTTGAGATGGGG - Intergenic
1194618182 X:96133622-96133644 TTGTTGTTCTTCAGTGAATAGGG - Intergenic
1195483526 X:105375203-105375225 TTGTTGTTCTTTAGGATACCTGG - Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1196561820 X:117158613-117158635 TTTTTGTTCATGAGGACACGAGG + Intergenic
1197337604 X:125226811-125226833 TTGTTGTTGTTGTTGAGATGGGG + Intergenic
1197379256 X:125719246-125719268 TTATTGTTTTTGAGGAATTAGGG - Intergenic
1197738473 X:129870877-129870899 TTGTTGTTGTTGTAGAGATGGGG + Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198495506 X:137188195-137188217 CCAGTGTTCTTGAGGAAATGAGG - Intergenic
1199455783 X:148026899-148026921 TTGTTTATTTTGAGGAAAAGAGG + Intergenic
1199481916 X:148307265-148307287 TTTTTGTTTTTGTAGAAATGAGG - Intergenic
1199763379 X:150922904-150922926 TTGTTGTTGTTGTAGAGATGAGG - Intergenic
1200463493 Y:3487092-3487114 TTCATTTTCTTGAGGAAATGTGG + Intergenic
1200969033 Y:9130238-9130260 TTGTTGTTTTGGAGGCACTGAGG + Intergenic
1201073069 Y:10167789-10167811 TTATTGCTTTTGAGGACATGGGG - Intergenic
1201434930 Y:13947327-13947349 TTTTTTTTCTTGTAGAAATGGGG + Intergenic
1201988500 Y:19995701-19995723 TTGTATTTTTTGTGGAAATGGGG + Intergenic
1202141796 Y:21732263-21732285 TTGTTGTTTTGGAGGCACTGAGG - Intergenic
1202145069 Y:21771539-21771561 TTGTTGTTTTGGAGGCACTGAGG + Intergenic
1202377671 Y:24252074-24252096 TTGTTGTTTTTGTAGACATGGGG + Intergenic
1202493110 Y:25418048-25418070 TTGTTGTTTTTGTAGACATGGGG - Intergenic