ID: 1004412302

View in Genome Browser
Species Human (GRCh38)
Location 6:15392071-15392093
Sequence TGTGTGTGCGTGTCTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5657
Summary {0: 1, 1: 1, 2: 78, 3: 1009, 4: 4568}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004412296_1004412302 30 Left 1004412296 6:15392018-15392040 CCAGTGCAGTGATCCCAGAGTGG 0: 1
1: 0
2: 2
3: 16
4: 137
Right 1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG 0: 1
1: 1
2: 78
3: 1009
4: 4568
1004412298_1004412302 17 Left 1004412298 6:15392031-15392053 CCCAGAGTGGTGTGTGTGTGTGT 0: 1
1: 18
2: 168
3: 710
4: 2431
Right 1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG 0: 1
1: 1
2: 78
3: 1009
4: 4568
1004412299_1004412302 16 Left 1004412299 6:15392032-15392054 CCAGAGTGGTGTGTGTGTGTGTG No data
Right 1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG 0: 1
1: 1
2: 78
3: 1009
4: 4568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004412302 Original CRISPR TGTGTGTGCGTGTCTGGAGG TGG Intronic