ID: 1004413243

View in Genome Browser
Species Human (GRCh38)
Location 6:15400826-15400848
Sequence TTGCTTATTACGTACAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004413238_1004413243 0 Left 1004413238 6:15400803-15400825 CCGCGCGGAATCTGCACTGCCGC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1004413234_1004413243 26 Left 1004413234 6:15400777-15400799 CCATTGCTGTTCTGGCCGTCCTA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1004413233_1004413243 27 Left 1004413233 6:15400776-15400798 CCCATTGCTGTTCTGGCCGTCCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1004413237_1004413243 7 Left 1004413237 6:15400796-15400818 CCTATTGCCGCGCGGAATCTGCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1004413232_1004413243 28 Left 1004413232 6:15400775-15400797 CCCCATTGCTGTTCTGGCCGTCC 0: 1
1: 0
2: 0
3: 1
4: 86
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1004413236_1004413243 11 Left 1004413236 6:15400792-15400814 CCGTCCTATTGCCGCGCGGAATC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004413243 Original CRISPR TTGCTTATTACGTACAGGGG AGG Intronic
907049929 1:51323134-51323156 TTGCTTATTGGGTAGAGGAGTGG - Intronic
912665571 1:111576594-111576616 TACCTTAATAAGTACAGGGGCGG + Intronic
915767759 1:158383168-158383190 CTGCTTATTAAGTAGACGGGCGG - Intergenic
1067858831 10:49822671-49822693 TTGCTTATTAGTTACAAGAGAGG + Intronic
1075085218 10:119410195-119410217 TTGCTTTTGACGTAAAGGGTCGG + Intronic
1077136643 11:1002861-1002883 TTGCTTCTTAGGCACTGGGGTGG + Intronic
1077547563 11:3182066-3182088 TTGCTTATTACTTATATGTGGGG + Intergenic
1078294003 11:10046897-10046919 TTGCTTATTAGTTCCAGGGATGG - Intronic
1087188289 11:95225965-95225987 TTGCTATTTAAGTGCAGGGGTGG + Intronic
1088284086 11:108167648-108167670 TGGCTTATTACATACAGGGTGGG + Intronic
1094236654 12:28175842-28175864 TTGCTTATTAGTTCCAGGAGGGG + Intronic
1095587694 12:43866212-43866234 TTTCTTATCACGAACAAGGGAGG + Intronic
1100446403 12:94664252-94664274 TTGCTTAATACCTGGAGGGGCGG + Intergenic
1104113459 12:125725811-125725833 TTGCTTATTACAGAGAGAGGAGG - Intergenic
1108669592 13:52671179-52671201 TTGCTTTTTTAGTACAGTGGTGG + Intronic
1111549727 13:89791157-89791179 TTAGTTATTATGTACAGTGGAGG + Intergenic
1133484321 16:6204087-6204109 TGTCTTATTAAGTACAGGGTGGG + Intronic
1139575229 16:67837344-67837366 TTGTATTTTACGTACAGGCGGGG + Intronic
1151198503 17:72449887-72449909 TTGCTTATTAGCTACAAGGGAGG + Intergenic
1156142909 18:34138437-34138459 TTGCTTATTTAGAACTGGGGAGG + Intronic
1166236316 19:41459693-41459715 TTGTTTCTAACGTACAGGGAAGG - Intergenic
929306816 2:40372754-40372776 TGGCTTATTAACTACAGGGGAGG - Intronic
931212249 2:60208315-60208337 TTGCTTTTGATGTACAGGGCTGG + Intergenic
935986398 2:108677486-108677508 TTGCTTCTTTCTTACAGAGGAGG - Intronic
936138844 2:109921147-109921169 TTGCTTCTTTCTTACAGAGGAGG - Intergenic
936205852 2:110450338-110450360 TTGCTTCTTTCTTACAGAGGAGG + Intronic
1182631617 22:31690355-31690377 TTGATTTTTTCGTACAGGTGGGG + Intronic
953352766 3:42228300-42228322 ATGCTTATTACTTACAAAGGGGG + Intergenic
955586067 3:60479575-60479597 TTGCATATTAGGTACAGCAGGGG + Intronic
962559158 3:136588151-136588173 TTGCTCATTATCTACTGGGGAGG + Intronic
967830703 3:193917359-193917381 TTGCTTATTTAGTAAAGAGGAGG - Intergenic
968723938 4:2230719-2230741 TTCCATATTACGAACAGGTGAGG + Exonic
973090677 4:46132509-46132531 GTGGTTATTACGTACAGGCCAGG + Intergenic
979647125 4:123083028-123083050 TTGCTTATTAGATTCAGGAGTGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
993262211 5:85673325-85673347 TATCTTATTACCTATAGGGGAGG - Intergenic
1004413243 6:15400826-15400848 TTGCTTATTACGTACAGGGGAGG + Intronic
1005895134 6:30171681-30171703 TTGCTGATTAGGTAGAAGGGCGG + Intronic
1006586858 6:35120787-35120809 TTGCTTATTAGGTGAAGGGAGGG - Intronic
1008119203 6:47591680-47591702 TAACTTATTACGTACAGTGTTGG + Intronic
1009222552 6:60997892-60997914 TTGCTTATAATATCCAGGGGAGG + Intergenic
1013652613 6:112211248-112211270 TTGCTAGTTACATACAGGGTTGG + Intronic
1016211375 6:141539040-141539062 TGGCTTACTACCTCCAGGGGTGG + Intergenic
1024106215 7:46089127-46089149 TTGCTTATCACACACAGTGGAGG - Intergenic
1027916491 7:84330025-84330047 TTGCTTATTAGGTAAAAGTGTGG - Intronic
1042666928 8:71217196-71217218 TTGCTTCTTTCTTACAGGAGAGG - Intronic
1045927360 8:107588505-107588527 TTGCTTATAATTTTCAGGGGGGG + Intergenic
1050443827 9:5696505-5696527 TTATTTATTGGGTACAGGGGCGG - Intronic
1052035337 9:23674135-23674157 TTCATCATTACGTAGAGGGGTGG + Intergenic
1052877446 9:33577878-33577900 CTGCTTCTAAGGTACAGGGGTGG - Intergenic
1186333614 X:8562443-8562465 TTGCTTATTACTGAAAGTGGAGG - Intronic
1201054573 Y:9975861-9975883 TGGCTTATTGGGCACAGGGGTGG + Intergenic