ID: 1004413724

View in Genome Browser
Species Human (GRCh38)
Location 6:15405420-15405442
Sequence GCTAGTCACCATCAGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004413724 Original CRISPR GCTAGTCACCATCAGCTGAC GGG (reversed) Intronic
901871483 1:12141316-12141338 GCCAGACACCATCAGCTGGGCGG + Intronic
902451936 1:16501687-16501709 GCCAGTCACCACCTGGTGACAGG - Intergenic
902501019 1:16911977-16911999 GCCAGTCACCACCTGGTGACAGG + Intronic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
916327794 1:163582514-163582536 GCTGATCACCATCAGTTGAGGGG - Intergenic
924677396 1:246193631-246193653 GCTAGTCATAATCAGCAGAAAGG + Intronic
1062975638 10:1680461-1680483 GCTGGTCCCCATCACCTGCCAGG + Intronic
1066578522 10:36853397-36853419 GCTAGTCATCTTCAGGTGAGTGG + Intergenic
1071066796 10:81645351-81645373 GTTAGTCATCATGAGCTGACAGG - Intergenic
1074557749 10:114507650-114507672 GCCAGTCACAGTCAGGTGACAGG + Intronic
1086327552 11:85719382-85719404 AAAAATCACCATCAGCTGACGGG - Intronic
1089639248 11:119836410-119836432 GCTAGTCAACAGGAGCTGCCCGG - Intergenic
1090251181 11:125252975-125252997 GCTATTCACCAGCAGCTCCCAGG + Intronic
1090533797 11:127618804-127618826 GCTACTCCCCATCTTCTGACAGG + Intergenic
1099075799 12:78106736-78106758 GCAAGCCACCATCAGCCCACTGG + Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1102941383 12:116945652-116945674 ACAAGTCACCAACAGCTGAAGGG - Intronic
1128067238 15:64773092-64773114 GCTAGTCTCCAAGAGTTGACTGG + Intronic
1137035032 16:35562771-35562793 CCTACTCACACTCAGCTGACAGG - Intergenic
1140189606 16:72803989-72804011 GGAAGAAACCATCAGCTGACTGG + Intronic
1144084519 17:11797053-11797075 ACTAGCCACCCTCAGGTGACTGG - Intronic
1148598181 17:48873509-48873531 GTTACTGACCATCAGCTGAAGGG - Intergenic
1149492248 17:57093408-57093430 GCTAGCCAGCATCAGATGGCTGG - Intronic
1159234217 18:65650204-65650226 GAAAGACACCATTAGCTGACTGG - Intergenic
1160222714 18:76988981-76989003 GCTAGCCACCCTCAGCAGGCAGG - Intronic
1167998177 19:53423572-53423594 GATGTTCACCACCAGCTGACTGG - Intronic
1168007654 19:53504166-53504188 GATGTTCACCACCAGCTGACTGG - Intergenic
934152404 2:89159963-89159985 GAAAGTCACCATCACCTGCCGGG - Intergenic
934214843 2:90021951-90021973 GAAAGTCACCATCACCTGCCGGG + Intergenic
934219594 2:90070004-90070026 GAAAGTCACCATCACCTGCCAGG + Intergenic
935546478 2:104405113-104405135 GCTTGTCACCAGCGGCTGGCAGG + Intergenic
940139700 2:150480468-150480490 GCCAGGCACCATGAGCTAACTGG + Intronic
941398940 2:165006750-165006772 GGTAGTCACCATCAGCCTGCGGG + Intergenic
943614705 2:190079963-190079985 CCTGGTCACCAACAGCTGGCAGG - Intronic
944468373 2:200026518-200026540 GCTAGTTAGCTTCAGCTGAGAGG + Intergenic
948830018 2:240594113-240594135 CCTGGTCACCTTCAGCTGTCAGG + Intronic
1181533410 22:23529925-23529947 GGTATTCACCAACAGCTGTCAGG - Intergenic
1181624905 22:24116666-24116688 GCAAGACACCAACAGCTGAGAGG - Intronic
1185156456 22:49196113-49196135 TCCAGTCACCATCAGCAAACAGG + Intergenic
950745095 3:15081755-15081777 GCTAGTCTTCCTCAGCTCACAGG + Intronic
950911875 3:16604505-16604527 GCAAGTCCCCCGCAGCTGACAGG + Exonic
957690194 3:83556527-83556549 GCCAGCCATCAGCAGCTGACTGG - Intergenic
969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG + Intronic
971294787 4:25378455-25378477 GCTAGTCTCCCTCCGCTGCCGGG + Intronic
972992324 4:44835925-44835947 TCCAGACACCATCAGCTGAGAGG + Intergenic
979378173 4:119974008-119974030 GGTGGTTACCAGCAGCTGACAGG + Intergenic
981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG + Intergenic
985199931 4:187474364-187474386 GCTAGTCAGCAGCAGATAACTGG + Intergenic
985231547 4:187823336-187823358 GCTAGTCTCAATCTCCTGACAGG + Intergenic
986699574 5:10392788-10392810 GTGAGTGACCAACAGCTGACTGG - Intronic
989976350 5:50591947-50591969 GGTAGTCACCATCAGAGAACTGG + Intergenic
990424169 5:55668891-55668913 ACAAGTCACCATTAACTGACAGG + Intronic
998112880 5:139515704-139515726 TCTAGGCAGCATCAGCTGGCTGG + Intergenic
999661226 5:153864600-153864622 GGTAGTGACCATCAGCTGTCAGG + Intergenic
999902147 5:156096138-156096160 GCTAGCCACCAGCAGCTCAGGGG + Intronic
1001242790 5:170082852-170082874 CCTAGTCAGCAGCAGCTCACAGG - Exonic
1004413724 6:15405420-15405442 GCTAGTCACCATCAGCTGACGGG - Intronic
1005759465 6:28954367-28954389 GGTTGTCACCATCAGCGGACAGG - Intergenic
1012567196 6:100672647-100672669 GCTAATCACCATCATGTAACTGG + Intronic
1012880096 6:104776732-104776754 ACAACTTACCATCAGCTGACTGG + Exonic
1023378086 7:39578037-39578059 GCTAGACACCAAGTGCTGACTGG - Intronic
1027196450 7:76033879-76033901 GCGATTCACTATCAGCTGCCTGG + Intronic
1033559677 7:142519729-142519751 GCTCCTCACCATCTGCTGATAGG + Intergenic
1034501701 7:151454946-151454968 GCCAGCCACCATCAGGTGACAGG + Intergenic
1040663209 8:49598998-49599020 GCTGGTTAACATCAGCTGGCGGG - Intergenic
1040849483 8:51884337-51884359 AATAGCCACTATCAGCTGACTGG + Intronic
1046181599 8:110656105-110656127 GCTGTTCACCATGAGCTGGCAGG - Intergenic
1049802420 8:144524152-144524174 GCTGGGCACCATCAGCCGAGAGG - Exonic
1055070031 9:72156769-72156791 ACTAGTCACCCTCAGCTACCAGG - Intronic
1187560982 X:20403454-20403476 GCTTGTCACCTTCAGCTCAATGG + Intergenic
1195786967 X:108536007-108536029 GCTATTCAACTTCAGCTTACTGG + Intronic
1197775168 X:130114189-130114211 GCCAGTCACCATGAGCTGGTTGG - Intergenic