ID: 1004423552

View in Genome Browser
Species Human (GRCh38)
Location 6:15492491-15492513
Sequence AAAAGGAAACAGAAGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1981
Summary {0: 1, 1: 0, 2: 11, 3: 205, 4: 1764}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004423552_1004423558 21 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423558 6:15492535-15492557 CTTATAGACAAGTCCAGGCCAGG No data
1004423552_1004423560 28 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423560 6:15492542-15492564 ACAAGTCCAGGCCAGGAAAAGGG No data
1004423552_1004423556 16 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423556 6:15492530-15492552 GGCTCCTTATAGACAAGTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 72
1004423552_1004423561 29 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423561 6:15492543-15492565 CAAGTCCAGGCCAGGAAAAGGGG 0: 1
1: 0
2: 3
3: 167
4: 995
1004423552_1004423555 -5 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423555 6:15492509-15492531 CTTTTGTACTGATTAAGTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 200
1004423552_1004423559 27 Left 1004423552 6:15492491-15492513 CCTCCATTCTTCTGTTTCCTTTT 0: 1
1: 0
2: 11
3: 205
4: 1764
Right 1004423559 6:15492541-15492563 GACAAGTCCAGGCCAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004423552 Original CRISPR AAAAGGAAACAGAAGAATGG AGG (reversed) Intronic
900378231 1:2370045-2370067 AAAAGGAAAAACAAAACTGGAGG + Intronic
900471398 1:2856752-2856774 AAATGGAAAGAGAAGAAGGGAGG - Intergenic
901183351 1:7356712-7356734 ATAGGGAAACAGTAGAATGTTGG + Intronic
901366785 1:8758666-8758688 AGAAGCAAAGAGTAGAATGGTGG + Intronic
901518506 1:9765578-9765600 AAAAAGAAAAAAAAAAATGGAGG + Intronic
901530799 1:9851334-9851356 AAAAAGAAAAAGAAGGATTGTGG - Intronic
901609001 1:10482123-10482145 AAAAACAAAAAGTAGAATGGTGG - Intronic
901640588 1:10691088-10691110 AAAAGGAAAGAGAGGGAGGGAGG - Intronic
901641915 1:10696931-10696953 CAAAGGCTACAGAGGAATGGCGG + Intronic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
902574029 1:17365874-17365896 AAAAAAAAAAAGTAGAATGGTGG + Intergenic
903185654 1:21627398-21627420 AAAAAAAAAAAGAAGAAGGGAGG - Intronic
903242833 1:21995127-21995149 AAAAAGAAAGAAAAGAAAGGGGG - Intronic
903407310 1:23108606-23108628 AAAAGGAAAGAAAATAATGCAGG + Intronic
903535065 1:24061315-24061337 AGAAGGACAGAGGAGAATGGGGG + Intronic
903605749 1:24573963-24573985 AAAAAAAAACAGAAAAAAGGGGG + Intronic
903609176 1:24597502-24597524 AAAAAGAAAGAGAAGGAAGGGGG + Intronic
903706994 1:25293181-25293203 AAAGGGGAACAGAGAAATGGAGG + Intronic
903720244 1:25400166-25400188 AAAGGGGAACAGAGAAATGGAGG - Intronic
903953299 1:27008966-27008988 AAAAAAAAAAAGAAGGATGGAGG - Intronic
904466242 1:30709344-30709366 ATGAGGAAACTGAAGCATGGAGG - Intergenic
904496822 1:30891865-30891887 AAGAGGAAGAAGAAGAAGGGAGG + Intronic
904547604 1:31288202-31288224 AAAAGCAATAAGAAGTATGGGGG + Intronic
904703470 1:32373142-32373164 AGAAATAAAAAGAAGAATGGGGG - Intronic
905100748 1:35520080-35520102 AAAAGAAAAAAGAAGATTTGAGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905208412 1:36356401-36356423 AAAAAGAAAAAGAAGAAATGTGG - Intronic
905234885 1:36539261-36539283 AAAATGAAGCAGGAGAAGGGAGG - Intergenic
905582987 1:39096234-39096256 AAAAAGAAACAGGTGAAAGGAGG + Intronic
905589169 1:39147169-39147191 GAAAGGAGAAAGAAGAAAGGAGG - Intronic
905606854 1:39308639-39308661 AAAAGAAAACTGAAGTATGAAGG - Intronic
905778524 1:40687148-40687170 AAAAGGTGAAAGTAGAATGGTGG + Intergenic
905795942 1:40816714-40816736 AAAAGGAAAGAGGATCATGGAGG - Intronic
905971145 1:42143425-42143447 AAAGGGGAAAATAAGAATGGAGG + Intergenic
906126372 1:43429505-43429527 AAAAAGAAAAAGAAATATGGAGG + Intronic
906147432 1:43568305-43568327 AAAAAGAAAAAGAAAATTGGTGG + Intronic
906428128 1:45731440-45731462 AAAACAAAACAGAACAAAGGTGG + Intronic
906552624 1:46678177-46678199 AAAAGGAAAGAGAAAAAAAGAGG + Exonic
906575832 1:46888624-46888646 AAAAGGATAGAAAAGATTGGTGG + Intergenic
906596142 1:47079270-47079292 AAAAGGATAGAAAAGATTGGTGG - Intronic
906626780 1:47332132-47332154 CAAAAGAAAAAGGAGAATGGGGG + Intergenic
906822162 1:48941008-48941030 AAAGAGAAAAAGAAGAAAGGAGG + Intronic
907026121 1:51121299-51121321 AGAAGCAGACAGTAGAATGGTGG - Intronic
907183915 1:52594563-52594585 AAAAGGAAAGCATAGAATGGGGG + Intergenic
907336903 1:53705702-53705724 AACAGGAGGCAGAAGAAGGGAGG + Intronic
907564257 1:55419993-55420015 TAAAAGAAAAAGAAGAATGGGGG + Intergenic
907697817 1:56751682-56751704 GAGAAGGAACAGAAGAATGGTGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907886738 1:58598989-58599011 AAAAAGAAAGAAAAGAATGGTGG - Intergenic
908176743 1:61563365-61563387 AAAAAAAAAAAGAAGAGTGGTGG + Intergenic
908195069 1:61740252-61740274 AATAGGAAAAAAAAGAAAGGTGG - Intergenic
908443128 1:64174921-64174943 AAAAGCAAAAGGAAAAATGGTGG + Intronic
908658626 1:66414599-66414621 AAAAGGAAACAGCAGAAACTTGG + Intergenic
908821116 1:68087573-68087595 GAAAAGAAACAAAAGAAGGGAGG - Intergenic
908896022 1:68900310-68900332 AAAAGGGGACAGAAAAATGATGG - Intergenic
909111235 1:71480393-71480415 AAAAGGAGAAAGAGGAAAGGAGG - Intronic
909184517 1:72469477-72469499 AAAAGAAAATAAAAGAAAGGAGG + Intergenic
909606236 1:77511401-77511423 AACAGGATAAAGAAGGATGGAGG + Intronic
909783273 1:79576738-79576760 AATAATAAACAGAAAAATGGAGG + Intergenic
910180317 1:84475716-84475738 AAGATGAAACACAAGAATAGAGG - Intergenic
910363372 1:86437512-86437534 GTAAGGAAAGAGAAGAAAGGAGG + Intronic
910468637 1:87527015-87527037 AGAATGTAACAGAAGAAAGGTGG - Intergenic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910718329 1:90256868-90256890 AAATGGAAAAAGAACAAGGGAGG + Intergenic
910720918 1:90285560-90285582 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
910746027 1:90575709-90575731 AAAAAGAAAAAGAAAAGTGGGGG + Intergenic
910797223 1:91109725-91109747 AAAAGGAGATAAAAGGATGGAGG - Intergenic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
911175632 1:94814976-94814998 AAAATAAGACAGAATAATGGAGG - Intergenic
911261289 1:95689464-95689486 AGAAGGAAACAGATAAATGCTGG + Intergenic
911289067 1:96033644-96033666 AAAAGTAAATAGATGCATGGAGG - Intergenic
911297773 1:96138565-96138587 AAAAAGAAAAAGAAAAAAGGTGG - Intergenic
911540395 1:99150834-99150856 AAAATGAAAAAGAGTAATGGTGG - Intergenic
911661522 1:100507458-100507480 AAAAAAAAAAAGAAGAATGATGG - Intronic
911708506 1:101042221-101042243 AAAATAAAACAAAACAATGGTGG - Intergenic
911728288 1:101265437-101265459 ACAAGGGAACATAAAAATGGGGG - Intergenic
911878037 1:103194528-103194550 AGAAGGAAAAAGAAGAAAGTGGG + Intergenic
912131069 1:106601093-106601115 AAAAGGTCACAGACTAATGGGGG - Intergenic
912172329 1:107116019-107116041 AAAATGGAAGAAAAGAATGGTGG + Intergenic
912179591 1:107203067-107203089 GAAGAAAAACAGAAGAATGGAGG - Intronic
912452518 1:109776145-109776167 GAAAGGAAACAGAAGTTAGGAGG + Intergenic
912504941 1:110150114-110150136 GAAAGGGAACAGAAGCACGGAGG + Intergenic
912904618 1:113691062-113691084 AGAAGGAAAGAGAAGAAAGAAGG + Intergenic
912986279 1:114435604-114435626 AAGAGGTACAAGAAGAATGGAGG + Intronic
913613059 1:120527422-120527444 AGAAGCAAAGAGTAGAATGGTGG + Intergenic
914137656 1:144915741-144915763 AAAAGGAAAGGAAAGAAAGGAGG + Intronic
914333384 1:146693631-146693653 AAAATCAAAGAGTAGAATGGTGG - Intergenic
914476642 1:148029063-148029085 AAAAGAAAAGAGAAGAAAAGAGG - Intergenic
914578127 1:148994827-148994849 AGAAGCAAAGAGTAGAATGGTGG - Intronic
914760752 1:150596072-150596094 AAAAGGAAAGGGAAGAACGCTGG + Intergenic
914763202 1:150615709-150615731 AAAAGGACATAGAAGAGAGGAGG - Intronic
914778703 1:150763248-150763270 AAAAGTAGAGAGTAGAATGGTGG + Intronic
914784824 1:150818891-150818913 AAATGGAAACACAAAAATGAAGG + Intronic
914814367 1:151052720-151052742 AAACAGAAACAGAAGATTAGAGG + Exonic
914820301 1:151096904-151096926 AAAAGAAAAAAGAAAAATGAGGG - Intronic
915036544 1:152932294-152932316 AGAAACAAACAGCAGAATGGTGG + Intergenic
915062373 1:153196917-153196939 AAAAGGAAACAGAAGCCTGGTGG + Intergenic
915312310 1:155010826-155010848 GAAAGGAGACAGAAGTAAGGGGG + Intronic
915446123 1:155975984-155976006 AAAAGAAAAAGGAAGCATGGAGG + Intronic
915741902 1:158125214-158125236 TAATAGAAACAGAAGAATGTAGG + Intergenic
915827237 1:159091021-159091043 AAATGGAAACATCAGAATGAAGG + Intronic
915859676 1:159430736-159430758 GGAAGGAGACAGAAGAAGGGAGG + Intergenic
915928334 1:160041355-160041377 AAAAGAGACCAGAGGAATGGGGG + Exonic
916149339 1:161771216-161771238 AAAAGGAGAAAGGAGAAAGGAGG - Intronic
916332668 1:163634616-163634638 AAAAGGAAACACTAGAATTTAGG - Intergenic
916572886 1:166042460-166042482 AAAAGAAAAAAGAAGAACAGAGG - Intergenic
916899025 1:169200776-169200798 GTCAGGAAACAGAAGAATAGGGG - Intronic
917045725 1:170857990-170858012 AGAAGGAAAAAGAAGAATCCAGG + Intergenic
917498148 1:175561437-175561459 TGAAGGGAACAGAAGAAAGGAGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917741707 1:177967569-177967591 AGAAGGAAAAAGAAAAAAGGGGG + Intronic
917794576 1:178523656-178523678 AATAGGGAAAAGAAGAAGGGTGG + Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917886795 1:179394139-179394161 AAAAGGAAACAGAAGAACCTTGG - Intronic
917902009 1:179552043-179552065 AAGAGGAAAGTGAAGAATGAAGG - Intronic
917996362 1:180442992-180443014 AAAAGGAAAAAAAAAAGTGGGGG - Intronic
918284191 1:183036032-183036054 ACATGGACACTGAAGAATGGTGG - Intronic
918480976 1:184976074-184976096 AAAAGGAAACAGAAATTTTGAGG - Intergenic
918623029 1:186626592-186626614 GAAAGGAAAGAAAAGAAGGGAGG - Intergenic
918694316 1:187524320-187524342 AAAATAAAACAGAAGCAGGGTGG - Intergenic
918707157 1:187678725-187678747 AAAATGAAACATAAAAATGTTGG - Intergenic
918760224 1:188394970-188394992 AAGAGGAAAGAAAAGAATAGTGG - Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919021789 1:192115160-192115182 AAAGAGAAAGAGAAGAAAGGTGG + Intergenic
919112503 1:193238305-193238327 AAAAGGAAAAAGAAGAAGCTAGG - Intronic
919146114 1:193637513-193637535 AGAAGCAAAGAGTAGAATGGTGG - Intergenic
919261342 1:195198522-195198544 AAAAAGAAAAAGAAAAATGTTGG - Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919483365 1:198116695-198116717 AGAAGGGGAGAGAAGAATGGTGG + Intergenic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
919698115 1:200600573-200600595 CAAATGAAATAGAAGATTGGAGG - Intronic
919846002 1:201642607-201642629 AAAAGGAAAGGGAAGGAAGGTGG - Intronic
919968701 1:202556201-202556223 AAATGAAAGCAGAGGAATGGTGG + Intronic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920061594 1:203230545-203230567 AAAAAAAAACAGAAGAATGGTGG + Intronic
921232720 1:213089448-213089470 AAAAACAAACAGCAAAATGGTGG - Intronic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
921626768 1:217385855-217385877 AAAAGGAAACAGAAGCAAAATGG + Intergenic
921967723 1:221108397-221108419 AAAAGCAAAAAGTAGAATAGTGG + Intergenic
922022981 1:221722767-221722789 AGCAGGAAACAGAAGAGTAGTGG + Intronic
922067290 1:222156735-222156757 AAAAGGAGACAGTAAAATGCAGG + Intergenic
922230921 1:223685051-223685073 AAAAGCAAAAAGAAGAAAGTAGG + Intergenic
922382334 1:225043284-225043306 AAAAAAAAAAAAAAGAATGGAGG + Intronic
922386647 1:225091889-225091911 AACAGGAAACAGAAAAAAGCAGG + Intronic
922418426 1:225442921-225442943 GTAAGGAAGAAGAAGAATGGAGG + Intergenic
922478950 1:225925197-225925219 AAAAGGAAACATCACATTGGTGG - Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922884760 1:229009639-229009661 AAAAGAAAAAAGAAGAAATGAGG + Intergenic
922907891 1:229189319-229189341 AAAAGGAAAGAGCAGAAGAGTGG + Intergenic
922935801 1:229421331-229421353 AAAAGAAAAGAAAAGAATGAAGG - Intergenic
922940403 1:229459563-229459585 TCATGGAAGCAGAAGAATGGTGG - Intronic
923028002 1:230221958-230221980 AAAAGAAGACAGAAGTAAGGAGG - Intronic
923146853 1:231204141-231204163 AAAAGGATAAAGAAGGCTGGCGG + Intronic
923192024 1:231628298-231628320 AAAAGATAAAAGAAAAATGGGGG + Intronic
923216237 1:231850655-231850677 AAAAAGAAAAAGAAGAAAAGTGG + Intronic
923353870 1:233134540-233134562 AAAAGAAAACAGAAGAAAAAAGG + Intronic
923858223 1:237867399-237867421 AAAAGGAGAGAGAAGAATGCTGG - Intergenic
923935172 1:238751933-238751955 CAAAGGAAAAAGAAAAATGTAGG + Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924048435 1:240055921-240055943 GAATGGAAACAGAAAGATGGTGG + Intronic
924052867 1:240094061-240094083 AAAATGAAAGAGAAGAATGATGG - Intronic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924471597 1:244347521-244347543 AAAAGTAAACAAAAGAATGAGGG + Intergenic
924579917 1:245314734-245314756 ATAAGGCAACTGACGAATGGAGG - Intronic
924828736 1:247570321-247570343 AAATGCAAACAGAAGAAAGCGGG - Intronic
1063240473 10:4164657-4164679 AAAAGGTAACAAAAGGGTGGGGG - Intergenic
1063301100 10:4849571-4849593 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1063315332 10:4998882-4998904 AAAATAAAACAGAAAAATTGGGG + Intronic
1063443780 10:6095204-6095226 AAAAGAAAAGAAAAGAATGAAGG - Intronic
1063641406 10:7834157-7834179 TAAAGGAAACAGCAGAGTGAAGG - Intronic
1063873179 10:10442337-10442359 AAATAGAAACAGTAGAATTGTGG + Intergenic
1064059651 10:12127387-12127409 AAAGAGAAAAAAAAGAATGGTGG + Intergenic
1064232181 10:13538681-13538703 AAAAGAAAAAAGAAAAAAGGTGG + Intergenic
1064293864 10:14059951-14059973 AAAAGGAAACCGAGGCATAGTGG + Intronic
1064402611 10:15034097-15034119 AAAAGAAAAAAAAAAAATGGTGG - Intronic
1064498887 10:15946860-15946882 GAAAGGAAAGAAAAGATTGGAGG + Intergenic
1064502075 10:15984532-15984554 AAAAGGAAATAGTGGAATGTAGG - Intergenic
1064620891 10:17216288-17216310 AAAAGAAAACAGAAGCATAATGG + Intergenic
1064639801 10:17404073-17404095 AAAAAAAAAAAAAAGAATGGAGG + Intronic
1064850853 10:19707119-19707141 AGAAGGAAGAAGAAGAAAGGAGG - Intronic
1065176004 10:23075950-23075972 AAAATGAATCAGAAGATTGAGGG + Intergenic
1065200328 10:23306538-23306560 AAAAAAAAAAAAAAGAATGGTGG + Intronic
1065434325 10:25691732-25691754 AAAAGGAAGCAGTAGATTGGGGG + Intergenic
1065437486 10:25717677-25717699 TAAGGGAGACAGAGGAATGGAGG - Intergenic
1065468437 10:26050764-26050786 AAAAGGAATCAGATGTCTGGAGG - Intronic
1065480845 10:26192637-26192659 AAAAGGAAAGAAAGGAAGGGAGG - Intronic
1065703874 10:28452538-28452560 AGAAGGAGAAAGGAGAATGGGGG - Intergenic
1065762933 10:28999828-28999850 AAAATTCAAGAGAAGAATGGAGG - Intergenic
1065773052 10:29095388-29095410 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
1066336531 10:34483507-34483529 AAAAAAAAACAGAAAAAAGGGGG + Intronic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066516690 10:36169589-36169611 AAAAGCAGAGAGTAGAATGGTGG + Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1067014171 10:42743861-42743883 AACCGGATACAGCAGAATGGCGG - Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067242762 10:44509979-44510001 AGAAGTAGACAGTAGAATGGTGG + Intergenic
1067374366 10:45713660-45713682 AAAAGGAAGAAGAGGAATGATGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067515142 10:46933489-46933511 AAAAGCAGATAGCAGAATGGTGG - Intronic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067647113 10:48118321-48118343 AAAAGCAGATAGCAGAATGGTGG + Intergenic
1067882179 10:50055292-50055314 AAAAGGAAGAAGAGGAATGATGG + Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068241559 10:54308417-54308439 AAAAAGAAACAGTCGAAAGGAGG - Intronic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068346569 10:55787535-55787557 AAAAGGAACAATAAGAATGAGGG - Intergenic
1068599355 10:58939514-58939536 AAATGGAAACAAAATAATGCAGG + Intergenic
1068717828 10:60207566-60207588 AAACGGAAACAGAAGATTACAGG + Intronic
1068885052 10:62089511-62089533 AAAAAGAAAAAGAAGGAAGGAGG - Intronic
1069059763 10:63883174-63883196 AAAAAGAAAAAAAAGAATAGAGG + Intergenic
1069087083 10:64153317-64153339 AGAAGGAAACAGTAGATTTGAGG + Intergenic
1069110053 10:64435909-64435931 AAAAAGAAAAAGAAAAAGGGAGG + Intergenic
1069183775 10:65396638-65396660 AACAGGAAACAGATAAATGGGGG - Intergenic
1069542464 10:69305556-69305578 AAAAAGAAAAAGAAGAAGGCTGG + Intronic
1069576824 10:69536626-69536648 AAAAGGACACAGCAAGATGGTGG - Intergenic
1070634519 10:78113634-78113656 AAAAGGAAAGAGAAAGAGGGAGG - Intergenic
1071013355 10:80965417-80965439 AAAAGGAAACAAAAGGAAAGAGG - Intergenic
1071146140 10:82574887-82574909 AGAAGCAAAGAGTAGAATGGTGG + Intronic
1071223749 10:83501039-83501061 AAAAGGAAACAGCAAAAAGGTGG + Intergenic
1071322120 10:84472574-84472596 AAAATAAAATAGAAGACTGGGGG + Intronic
1071386264 10:85124366-85124388 AAAAGGAAGACTAAGAATGGAGG - Intergenic
1072095207 10:92171552-92171574 AAAAGGAAACAAAGGAAGGGGGG + Intronic
1072166022 10:92813865-92813887 AAAAGGAAAGAGAGAAATGGGGG - Intergenic
1072416969 10:95256397-95256419 AGAAGGAAAAACAAAAATGGAGG + Intronic
1072678422 10:97486615-97486637 AAAAGCAGAGAGTAGAATGGTGG + Intronic
1072857673 10:98966557-98966579 AACAGGAAACAGTTAAATGGTGG + Intronic
1073028239 10:100504228-100504250 AAAAAGAAAAAGAAGTAGGGAGG - Intronic
1073052695 10:100678910-100678932 ATAAGGAGACAGAAGCTTGGGGG + Intergenic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073680102 10:105693867-105693889 AAAAAAAAACAGAGGAAGGGAGG - Intergenic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1073883931 10:108015913-108015935 AAAAGGAAAAAGAGAGATGGGGG - Intergenic
1073946779 10:108759957-108759979 AAAGGAAAACAGATGAAAGGAGG + Intergenic
1073973186 10:109068487-109068509 AGAAGGAAACATAGGAATAGAGG + Intergenic
1074002115 10:109383833-109383855 AGAAAGAAAAAGAAGGATGGTGG - Intergenic
1074380037 10:112971911-112971933 AAAAGGAAAGAAAAAAATGACGG - Intronic
1074967465 10:118504045-118504067 AAAAGTAAACAGAGGAAGGAAGG + Intergenic
1075123549 10:119681791-119681813 AAAAAGAAAAAGAAAAGTGGGGG - Intergenic
1075250092 10:120861045-120861067 AAGGGGATGCAGAAGAATGGGGG + Intronic
1075280798 10:121136515-121136537 GAAAGGATATAGAAGAATGCAGG - Intergenic
1075403234 10:122176182-122176204 AAAAGGCCAAAGTAGAATGGTGG + Intronic
1075471332 10:122692338-122692360 AAAAAGAAAAGGAAGAAGGGAGG - Intergenic
1075496387 10:122922915-122922937 AAAAGGAGAAAGAAGAGTAGGGG + Intergenic
1075648033 10:124109307-124109329 AAAAGGAAACCAAAGAAGGATGG + Intergenic
1075883053 10:125871230-125871252 AAAAGGAAAATGAAGACTGTTGG - Intronic
1076289062 10:129330103-129330125 AAAAAAAAAAAAAAGAATGGGGG + Intergenic
1077003841 11:341120-341142 AAAAGGAAAGAGGAGGAAGGAGG + Intergenic
1077345871 11:2052769-2052791 AAATGGAGACTGAAGAATGTTGG - Intergenic
1077891880 11:6424560-6424582 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1077925220 11:6675075-6675097 AGGAGGAAACAGGAGAAGGGAGG + Intergenic
1077978223 11:7272357-7272379 AAAAGAAAAGAGATTAATGGAGG - Intronic
1078194386 11:9122905-9122927 AAAAAGAAAAAGAATAATGTTGG + Intronic
1078745682 11:14112119-14112141 AAAAGGAAAAAGAAAAAAGCTGG + Intronic
1078892168 11:15567260-15567282 AGAAGGAAACGGAAGGAAGGAGG - Intergenic
1078903107 11:15660112-15660134 AGAAGGATGCAGAAGAATGCAGG + Intergenic
1078905355 11:15682455-15682477 AAAAGGAAAAACAAAATTGGAGG + Intergenic
1078960851 11:16268003-16268025 AGAAGGAGAGAGTAGAATGGTGG + Intronic
1078984841 11:16583466-16583488 AAAAGTAGACAGTAGAATAGTGG - Intronic
1079379944 11:19929263-19929285 AAAAAGAAACAGACAAAGGGAGG + Intronic
1079387359 11:19992438-19992460 AAAAGGAAAGAGCTGTATGGTGG + Intronic
1079771579 11:24467189-24467211 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1080000057 11:27337123-27337145 AAAATAAAATAAAAGAATGGTGG - Intronic
1080086062 11:28283904-28283926 AAAGGAAAAAGGAAGAATGGAGG + Intronic
1080148187 11:29015415-29015437 AAAAGGTAACAGAAAAGTGATGG - Intergenic
1080181271 11:29429250-29429272 AAAAGGTAACAGCTGAATGAGGG - Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080883065 11:36340689-36340711 AAAAGGAGAGAGAAGCAGGGAGG + Intronic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081040573 11:38205370-38205392 AAAAAGAAGAAGAAGAATAGAGG + Intergenic
1081305338 11:41505044-41505066 AAAAGGAAGAAGAAGAAAGAAGG - Intergenic
1081322147 11:41704510-41704532 GAAAGAAAACTGAAGTATGGAGG - Intergenic
1081336643 11:41874854-41874876 AAAAAGAAAAAGAAGAAAGAGGG + Intergenic
1081442407 11:43094671-43094693 AAAAGCAGACAGTAGAATCGTGG + Intergenic
1081691225 11:45080060-45080082 AGAAAGAAATAGAAGACTGGGGG - Intergenic
1081796856 11:45826444-45826466 ACATGGAAACAGAGGCATGGGGG - Intergenic
1081841483 11:46204619-46204641 AAAGGAAAAAAAAAGAATGGAGG + Intergenic
1082184299 11:49161451-49161473 AATAGAAAACAGAAAAATGCAGG - Intronic
1082213231 11:49532442-49532464 AAAAAGAGACATAATAATGGGGG - Intergenic
1082250646 11:49976455-49976477 AAAAGGAGTCAGCAGAATGGGGG + Intergenic
1082283219 11:50293470-50293492 AAAAGGAATCAGAAGTATCAAGG + Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083114631 11:60448402-60448424 AAAAGGAAACTGAAGCACAGAGG + Intronic
1083145198 11:60752943-60752965 AAAAGGAAAGAGAAGGAGCGTGG + Intergenic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1084423003 11:69069983-69070005 AAAAGGAAAAAAAAGAAAGGAGG - Intronic
1084682035 11:70672042-70672064 AAAAGAAAAGAAAAGTATGGTGG - Intronic
1084838974 11:71829833-71829855 AAAAGCAGAGAGTAGAATGGTGG + Intergenic
1084923914 11:72496236-72496258 AAAAAAAAAAAAAAGAATGGTGG + Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085094538 11:73749128-73749150 AAAAGGAAAAAAAAGAAATGTGG + Intronic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085699329 11:78732269-78732291 AAAATGAAATAAAAGCATGGTGG + Intronic
1085791559 11:79501396-79501418 ATAAGCAAACAGAAGCAGGGCGG - Intergenic
1085827379 11:79862218-79862240 AACAGAAAACAGAAGAAAGCAGG + Intergenic
1085952641 11:81350971-81350993 AAAAGCAAAGAAAAGAATGGTGG - Intergenic
1085954426 11:81374086-81374108 AAAAGGAAAAGGAAGAAGGAAGG - Intergenic
1085996720 11:81925798-81925820 AAAAGTAAGCACAAAAATGGAGG - Intergenic
1086036846 11:82426125-82426147 AAAAGGAAAGAAAAGAAGGAAGG + Intergenic
1086410463 11:86539742-86539764 AAAAGGACAAAGAATAATGTGGG - Intronic
1086506473 11:87509750-87509772 AAAAAGAAAAGGAAGAAGGGAGG - Intergenic
1086532445 11:87801482-87801504 GAAAGGAAACTGAAGCAGGGTGG - Intergenic
1086636375 11:89092097-89092119 AAAAAGAGACATAATAATGGGGG + Intergenic
1086682050 11:89683928-89683950 AATAGAAAACAGAAAAATGCAGG + Intergenic
1086918102 11:92554485-92554507 AAAAAAAAAAAAAAGAATGGAGG + Intronic
1087048944 11:93867356-93867378 TAAAGGGAGCAGAAGAGTGGAGG + Intergenic
1087101140 11:94366022-94366044 AGAAGTAGACAGTAGAATGGTGG + Intergenic
1087186072 11:95197292-95197314 AAAAGCAAAAGGTAGAATGGTGG - Intronic
1087406992 11:97743088-97743110 AAAAGAAAAAAAAAGAAAGGGGG - Intergenic
1087424582 11:97970992-97971014 AAAAGGAAAGAGAAGACTAAGGG - Intergenic
1087492071 11:98840979-98841001 AAAAGGAAAGAGAAGAGAGAGGG - Intergenic
1087507303 11:99042348-99042370 AAAAAGAAGAAGAAGAAGGGAGG - Intronic
1087571193 11:99929299-99929321 AAAAGAAGACAGAAAAATGTAGG - Intronic
1087873552 11:103327822-103327844 AACATGAAATAGAAGATTGGTGG - Intronic
1088177884 11:107074389-107074411 TTAAGGAAAGAGAAGAAGGGTGG + Intergenic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088405881 11:109478275-109478297 AAAAGTAGAGAGAAGAATAGTGG + Intergenic
1088738114 11:112745373-112745395 AAGAGGAAACTGAGGCATGGGGG + Intergenic
1089050897 11:115544982-115545004 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1089099255 11:115947234-115947256 GAAAGGAAAGAAAAGAAAGGAGG + Intergenic
1089228662 11:116949761-116949783 AAAAAGAAAAAGAACAGTGGAGG - Intronic
1089257446 11:117201270-117201292 ATAAGGAAACAGACGCAAGGAGG + Intronic
1089314115 11:117579002-117579024 AAAGGAAAACAGAAGAATCAAGG - Intronic
1089399682 11:118157256-118157278 AAACAGAAACAGAGGAAGGGAGG - Intergenic
1089590903 11:119540232-119540254 ATAATGAAACAGAAGAAAGATGG + Intergenic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089714307 11:120342115-120342137 AAAATGAAAAAAAACAATGGGGG - Intronic
1090301678 11:125646909-125646931 ACAAGAAAACAAAAGAATGGGGG - Intronic
1090374318 11:126278127-126278149 AAGAAGAGACAGAAGACTGGAGG - Intronic
1090401849 11:126454157-126454179 AATAGGAAAGAGAAGAAGGTGGG - Intronic
1090773233 11:129940839-129940861 AAAAGGAAACAACAGAAAGGGGG - Intronic
1090941088 11:131389045-131389067 AAAAGGAAAAAGAAAGATGGTGG + Intronic
1091033609 11:132213722-132213744 AAAAAAAAAAAAAAGAATGGTGG - Intronic
1091073928 11:132596345-132596367 AAAAAGAAAAAGAAGAAAGGAGG - Intronic
1091239071 11:134040383-134040405 AAGAGGAAAGATAAGAATGAGGG + Intergenic
1091343121 11:134835348-134835370 GAAAGGAAACAGAAGAAGATGGG - Intergenic
1091586612 12:1820560-1820582 AGAAGGAAAGAGAGGGATGGAGG - Exonic
1091947193 12:4557665-4557687 ACAAGGAAACAGTGGAATGATGG + Intronic
1091956696 12:4649795-4649817 GAAAGGAAAGTGAAGAATGAAGG + Intronic
1092116215 12:6009937-6009959 AGAAGCAAAAAGCAGAATGGTGG + Intronic
1092184551 12:6469354-6469376 AGAAGGCAACAGAAAAATCGTGG - Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092399700 12:8164266-8164288 AAAAGCAGAGAGTAGAATGGTGG - Intronic
1092458479 12:8665951-8665973 AAAAGGAAGGAAAAGAAAGGGGG + Intergenic
1092803365 12:12194885-12194907 AAAAGTAAAGAGTAGAATAGGGG - Intronic
1092811301 12:12273694-12273716 AAAAGAAAAAAGAAAAATAGAGG - Intergenic
1093115348 12:15203256-15203278 AAAAGGAAACCCAAAAATGGGGG - Intronic
1093222528 12:16439896-16439918 AAAATGAAACAGGAGAGTGCTGG - Intronic
1093262575 12:16957376-16957398 AAATGGAAAGAGAAAAAAGGAGG - Intergenic
1093278621 12:17161080-17161102 AAAAGTGAACTGAAGAATGAAGG - Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093415374 12:18914336-18914358 GGAAGGAAAGAAAAGAATGGAGG - Intergenic
1093573203 12:20693408-20693430 AAAGAGAAACAGGAGAATTGAGG + Intergenic
1093675057 12:21928431-21928453 AAAAGAAAAGAAAAGAAGGGAGG + Intronic
1093734606 12:22606348-22606370 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1093787380 12:23208176-23208198 CAAAGGGAACAGCAGCATGGTGG - Intergenic
1093884746 12:24446859-24446881 AGAGGGAAACAAAATAATGGAGG + Intergenic
1094019666 12:25900907-25900929 GAAAGGAAGGAGAAGAATGGCGG + Intergenic
1094083667 12:26565808-26565830 AAAAGGAAAGAAAAGAAGAGAGG + Intronic
1094129867 12:27063282-27063304 AAAAGGAGAAAGAAGAAAGAAGG - Intronic
1094165102 12:27435490-27435512 AATAGGAATCAGATGAGTGGTGG - Intergenic
1094176807 12:27549569-27549591 AAAAAAAAAAAGAAGAATGAAGG + Intronic
1094318282 12:29156037-29156059 AAAAGTAGAGAGAAGAATGGTGG + Intronic
1094404640 12:30103668-30103690 AACAGAAAACAGAAAAATAGAGG - Intergenic
1094412713 12:30184248-30184270 ATAAGGAAAAAGAAGAAGAGTGG - Intergenic
1094545721 12:31403372-31403394 AAAAGAAAAAAAAAGAAGGGAGG - Intronic
1094704792 12:32904224-32904246 AAAAGAAAAGAAAAGAAGGGAGG - Intergenic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095444506 12:42270668-42270690 AAAAGGAAAAAAAAAAAGGGTGG + Intronic
1095498059 12:42806535-42806557 AAAAGAAAAGAAAAGAATGAAGG - Intergenic
1095522360 12:43082607-43082629 AGAAAAAAACATAAGAATGGAGG - Intergenic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1095682262 12:44991610-44991632 AAAAAAAAAAAAAAGAATGGTGG + Intergenic
1095811660 12:46378503-46378525 AAAAGAAAAAAGAAAAAGGGAGG - Intergenic
1095846593 12:46752480-46752502 AGAAGCAAAAAGTAGAATGGTGG + Intergenic
1095853480 12:46835516-46835538 AAAAATAAAGAGAAGATTGGTGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1095991281 12:48036331-48036353 AGAAGTAGACATAAGAATGGAGG - Intergenic
1096133454 12:49179770-49179792 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
1096323785 12:50639892-50639914 AAAAGCAGAGAGTAGAATGGTGG + Intronic
1096353507 12:50919450-50919472 AAAATGGAAAAGAAGAATGTAGG - Intergenic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096438261 12:51614816-51614838 AAAAGGAATAAGAAGAAGAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096709231 12:53443262-53443284 AAGATGACAAAGAAGAATGGAGG - Intronic
1096918012 12:55054258-55054280 AAATGAGAACAGAAGAATGCAGG + Intergenic
1096943070 12:55371001-55371023 AGAAGGAGAGAGCAGAATGGTGG - Intergenic
1096961292 12:55580558-55580580 AAGATGACACAGAAGAATCGAGG + Intergenic
1096982260 12:55735176-55735198 AAAAAATAACAGAAAAATGGTGG + Intergenic
1097097139 12:56558572-56558594 AAAAGGAAAAAGAAAAAGGAAGG - Intronic
1097480311 12:60116106-60116128 GAAAGGAAACAGAAGAGAGGAGG + Intergenic
1097625429 12:61994370-61994392 AAAAGGCAACAGGAGGAAGGAGG - Intronic
1097704843 12:62857372-62857394 AGAAGCAAAGGGAAGAATGGTGG + Intronic
1097798044 12:63884711-63884733 AAAAAAAAAAAAAAGAATGGTGG - Intronic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1098042204 12:66363794-66363816 AGAAGCAAAAAGTAGAATGGTGG + Intronic
1098088843 12:66879267-66879289 AAAAGGAAAAAAAAAAGTGGAGG + Intergenic
1098194053 12:67980833-67980855 AAGAGGCACCAGAATAATGGTGG + Intergenic
1098219610 12:68254980-68255002 AGAAGGAAAGAGTAGAATGGTGG + Intergenic
1098295352 12:68998603-68998625 AAAAGGAAAATAAATAATGGTGG - Intergenic
1098331742 12:69360241-69360263 AAAAACAAACAGATAAATGGTGG + Intronic
1098489255 12:71055876-71055898 AAAAAGAAAAAGAAGAAATGTGG - Intronic
1098542729 12:71676007-71676029 GAAAGGAAAAAAAAGAATGACGG + Intronic
1098632138 12:72737177-72737199 AAAAGAAAACTGAAGCCTGGAGG - Intergenic
1098822941 12:75255821-75255843 AAAAGGAAATAGAAGAAATGGGG - Intergenic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1099093454 12:78341880-78341902 AAAGGGAGAGAGGAGAATGGGGG - Intergenic
1099509298 12:83513626-83513648 AAAAGGAAAAATAAGCATGAAGG - Intergenic
1099703487 12:86119714-86119736 AAAAAAAAAAAAAAGAATGGTGG - Intronic
1099732512 12:86523909-86523931 AAATGAAAACAGAAGAAAGCAGG - Intronic
1099963692 12:89422023-89422045 AAAAAGATACAAAAGAATGAAGG - Intronic
1100176114 12:92032897-92032919 AAAAGGCTGCAGAAGAATGAAGG - Intronic
1100189701 12:92177308-92177330 AAAAGGAATAAAGAGAATGGAGG + Intergenic
1100506505 12:95225789-95225811 AAAAAGAGAGAGAAGGATGGAGG + Intronic
1100594016 12:96056018-96056040 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100864935 12:98847291-98847313 AAAAGCAGGCAGTAGAATGGTGG - Intronic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1100974057 12:100102507-100102529 AAATGGAAGCAGAAGAATTTAGG - Intronic
1101137894 12:101764327-101764349 AAAAGAGAACAGTAGAATGGAGG - Exonic
1101239241 12:102821771-102821793 AAAAGGAAAGGGCAGAAGGGTGG + Intergenic
1101374150 12:104156551-104156573 ACATGGAAAAAGAAAAATGGAGG - Intergenic
1101521896 12:105491484-105491506 AGAAGTATACAGAAGAATGGTGG - Intergenic
1101558767 12:105835719-105835741 AAACTGAACAAGAAGAATGGAGG - Intergenic
1101610770 12:106289585-106289607 ATATGAAAACAGAAGCATGGTGG + Intronic
1101729431 12:107414698-107414720 AAAAGAAAAGAAAAGAAAGGGGG - Intronic
1101797986 12:107993871-107993893 AAAAGTAAAGAGTAGAATAGTGG - Intergenic
1101921874 12:108939692-108939714 AAAAGGAAACAGAATGTTGGTGG - Intronic
1102008993 12:109606666-109606688 AGCAGGAATCACAAGAATGGGGG - Intergenic
1102668750 12:114599480-114599502 AGAAGGAGAGAGAAGAATGGAGG - Intergenic
1102682925 12:114702703-114702725 AAAAGGAAACATAAGAAAGATGG + Intergenic
1102843996 12:116158108-116158130 AACAGGAAACAGATGAACGCAGG + Intronic
1103064753 12:117888141-117888163 AAATGAAAACTGAAGAATGCTGG - Intronic
1103159906 12:118720637-118720659 AGAAGGAAAGAGAAGAAAGAAGG - Intergenic
1103288064 12:119819569-119819591 AACAAGAAAAAGAAGAATTGGGG + Intronic
1103313438 12:120031591-120031613 AAAAGGAAACTGAAGTATGTAGG - Intronic
1103404558 12:120666218-120666240 AAAAGGAAGAAGAAGAAGGGAGG + Intronic
1104045743 12:125161355-125161377 AAAGAGAAACAGAGGAAAGGGGG - Intergenic
1104148478 12:126058119-126058141 AAAAGGAAACAAAACAATTAAGG + Intergenic
1104194543 12:126521424-126521446 AAAAGCAGACAGTAGAATGGCGG - Intergenic
1104235779 12:126935201-126935223 AAAAGCAAAGAGTAGAATGATGG + Intergenic
1104626497 12:130360287-130360309 AAAAGGGAAGAGAAGAATCTGGG + Intronic
1104696759 12:130870065-130870087 AAAAGGAAATAGAACATTGCAGG + Intergenic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1105028070 12:132862884-132862906 AAAAGAAAACAAAAGAAATGAGG - Intronic
1105223497 13:18356568-18356590 AAAAGGCAGCAGAAAAAAGGGGG - Intergenic
1105359133 13:19690792-19690814 AAGAGGAAAGAGAAGAAAGTTGG - Intronic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1106061173 13:26293951-26293973 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1106293454 13:28388015-28388037 AAAAGCAAACAGAATGATTGAGG - Intronic
1106742274 13:32657385-32657407 AACAGAAAACAGAAGAAAGCAGG - Intronic
1106887135 13:34199325-34199347 AAAAAGAAAGAGTAGACTGGTGG + Intergenic
1107068091 13:36238890-36238912 AAAAGGAAACAGAACAGAAGAGG + Intronic
1107167639 13:37301182-37301204 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1107728422 13:43323650-43323672 AGAGGGAAAAAGAATAATGGAGG - Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108066381 13:46581807-46581829 AAAAAGAAACAGGAGCATGTGGG - Intronic
1108082329 13:46749346-46749368 AAAAGCAGAGAGTAGAATGGTGG + Intronic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1108131626 13:47308110-47308132 AAAAGTAAACAGAGGAAAGTAGG - Intergenic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108328375 13:49358362-49358384 GAAAGGAAATAGAATAATGGTGG + Intronic
1108380815 13:49852562-49852584 AAAAGAAAAGAAAAAAATGGTGG + Intergenic
1108453073 13:50586665-50586687 AAAAGGAAACACAATAGTGGTGG - Intronic
1108526955 13:51293608-51293630 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1108527552 13:51298947-51298969 GAATGGAAACTGAACAATGGTGG - Intergenic
1108677989 13:52754331-52754353 AAACGAAAACAGAAAAATGATGG + Intergenic
1108756353 13:53507723-53507745 ATGAGGACACAGAAGCATGGTGG - Intergenic
1108778014 13:53790440-53790462 AAAAGCAGACAGTAAAATGGTGG - Intergenic
1108850510 13:54722457-54722479 AGAAGCACACAGTAGAATGGTGG - Intergenic
1108880084 13:55102212-55102234 AAATGTATACAGAAAAATGGAGG - Intergenic
1108954236 13:56132472-56132494 AGAAGGCAAGAGTAGAATGGTGG + Intergenic
1109084785 13:57956033-57956055 AGAAGGAGAGAGTAGAATGGTGG - Intergenic
1109138157 13:58679641-58679663 AACAGCAAAAAGTAGAATGGTGG - Intergenic
1109284242 13:60393607-60393629 AAAAGGAAAAAAGAGAAAGGAGG - Intergenic
1109337994 13:61017469-61017491 AAAATAAAAAAGATGAATGGAGG - Intergenic
1109338656 13:61026089-61026111 AAAAAGATACAGAAGAACAGAGG + Intergenic
1109343438 13:61089607-61089629 TAAGGGAGACAGAGGAATGGAGG - Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109574453 13:64235070-64235092 AAAAACAAACTGTAGAATGGTGG + Intergenic
1109700484 13:66018587-66018609 AAAAGTAGACAGAAGAGTGAAGG - Intergenic
1109900198 13:68758603-68758625 AAAATGAAAAAGAAGAAAGAAGG + Intergenic
1109927086 13:69157959-69157981 AAAAGGAGGCAGAAGAACGTGGG - Intergenic
1110168100 13:72468149-72468171 AAAGGAAAATAAAAGAATGGAGG + Intergenic
1110554660 13:76844947-76844969 AAAAGCAAGAAGCAGAATGGTGG + Intergenic
1110724326 13:78802125-78802147 AAAAGTAGAGAGCAGAATGGTGG - Intergenic
1110770584 13:79339221-79339243 AGAAGCAGACAGCAGAATGGTGG + Intronic
1110874533 13:80491950-80491972 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1110984091 13:81941091-81941113 AAAAGTAAAGACTAGAATGGTGG - Intergenic
1111086498 13:83381476-83381498 AAAAGCAAGCAGAAGAACGTGGG - Intergenic
1111336320 13:86828860-86828882 AAAAGTAAATAATAGAATGGTGG - Intergenic
1111675243 13:91378867-91378889 AAAAGGAAAGAGAGGAAGGAAGG + Intergenic
1111761668 13:92474162-92474184 AAAAGGACAGAGGAGAATTGTGG - Intronic
1111783811 13:92762937-92762959 AAAAGGAAACAGAAATCTTGGGG - Intronic
1111877973 13:93920286-93920308 AAAAGGAAACAGGACCTTGGGGG - Intronic
1111972448 13:94931017-94931039 AAAAAGAAAAAGAAGAAATGGGG - Intergenic
1112062735 13:95757352-95757374 GAAAGGACAGAGAAGAACGGAGG - Intronic
1112203655 13:97302831-97302853 AAAAGGACAGTGAAGAAGGGAGG + Intronic
1112228157 13:97561352-97561374 AAATGGAAACAGTAGAAAGGAGG + Intergenic
1112233591 13:97613828-97613850 AAAAGGAAGAAGAAGAATCTTGG + Intergenic
1112275545 13:98014825-98014847 AAAAAAAAAGAGAAGAATTGAGG - Intronic
1112281021 13:98063364-98063386 ACAAGGAAACAGAACAATAGAGG + Intergenic
1112299293 13:98215772-98215794 AAAAAGAAAAATATGAATGGAGG - Intronic
1112300774 13:98227914-98227936 AAATAGAAACAGTAGAATGGTGG + Intronic
1112346227 13:98592388-98592410 ATAAGGATAAAGAAGGATGGCGG + Intergenic
1113158792 13:107355278-107355300 AAAAGGGAAAAAAAGAAGGGAGG + Intronic
1113282313 13:108802271-108802293 AAAAGTAGAGAGAAGAATGATGG - Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113392561 13:109911494-109911516 AAAAAGAAAAAGAAAAAAGGGGG + Intergenic
1113498165 13:110750198-110750220 AAAAGAAAAGAGAGGAATAGAGG - Intergenic
1113659800 13:112098158-112098180 ACAAATAAACAGAATAATGGTGG - Intergenic
1113706894 13:112440913-112440935 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
1113761228 13:112848093-112848115 AAAAAGAAACGGAGGAAGGGCGG + Intronic
1113830874 13:113294832-113294854 AAAAGAAAAGAAAAGAAGGGAGG + Intergenic
1114042446 14:18691491-18691513 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1114071322 14:19110119-19110141 AACTGGATACAGCAGAATGGCGG + Intergenic
1114090940 14:19289847-19289869 AACTGGATACAGCAGAATGGCGG - Intergenic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114302788 14:21393413-21393435 AAAGGGAAAGAGAAGAGAGGGGG + Intronic
1114315905 14:21509758-21509780 AACAGGAAACCAAAGAATAGGGG + Intronic
1114324275 14:21573299-21573321 AAAAGAAAAAAAGAGAATGGTGG + Intergenic
1114358503 14:21942186-21942208 AGAAGGGAAGAGAAGAAAGGAGG + Intergenic
1114390586 14:22303821-22303843 AAAAAAAAACAAAAGAATGGGGG - Intergenic
1114708095 14:24747860-24747882 AAAAAGAAAAAAAAGAATGTTGG + Intergenic
1114820782 14:26016952-26016974 AAGAGAAAACAGAAAAATGTAGG + Intergenic
1114866121 14:26597663-26597685 GAAAGGAGACAGGGGAATGGAGG + Exonic
1115167031 14:30459897-30459919 AAATGGAACCAGAATACTGGAGG - Intergenic
1115275643 14:31605990-31606012 AAAAGGAAGAAGGAGAAGGGAGG - Intronic
1115384652 14:32782168-32782190 AAAAGGAAAGAAAGGAAGGGAGG + Intronic
1115466606 14:33721718-33721740 AGAAGGAAACTAAAGAATGCAGG + Intronic
1115595086 14:34901560-34901582 AAAAAAAAAAAAAAGAATGGAGG + Intergenic
1115864275 14:37726072-37726094 AAAAGGAAAAAGCAGAAAAGAGG - Intronic
1116096397 14:40375662-40375684 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
1116158706 14:41239106-41239128 AGAAGCAAACAGGAGAATTGGGG + Intergenic
1116193400 14:41688925-41688947 AAAAGGAAAAAGAAAAAAGCTGG + Intronic
1116611493 14:47078970-47078992 AAAAGTAGAAAGTAGAATGGTGG - Intronic
1116621031 14:47203376-47203398 AGAAGGAAAGAGAAGCATGCAGG + Intronic
1116744591 14:48800764-48800786 AAAAGGAAACAACAGAGTGAAGG - Intergenic
1116831011 14:49719758-49719780 AAAAAGAGAAAGAAAAATGGAGG - Intronic
1116939799 14:50779767-50779789 AAAAGAAAAGAAAAGAAGGGGGG + Intronic
1117246814 14:53894956-53894978 AAAAGGAAAAATAAAAAAGGAGG - Intergenic
1117283758 14:54266056-54266078 GAAAGGAAACAGAAAAAGGTCGG - Intergenic
1117362102 14:54985837-54985859 AAATGGAAAGAGAAGAATCGAGG + Intronic
1117514885 14:56491141-56491163 AAAAGCAAAAATAAGAATAGTGG - Intronic
1117653911 14:57934849-57934871 GAAAAGACACAGAAGAATGAGGG + Intronic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1117724641 14:58660789-58660811 AGAAAGAAATAGAAAAATGGGGG + Intergenic
1117744040 14:58849418-58849440 AAAAGGAAATATAACAATTGAGG - Intergenic
1117909310 14:60621419-60621441 AAAAAGAAACAGAAGAAGAAAGG + Intergenic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118142500 14:63099845-63099867 AAAAGGACAAAGAAGAAAGTGGG - Intronic
1118287916 14:64493854-64493876 AAAAAGAAGAAGAAGAATAGGGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118415307 14:65529216-65529238 AAAAAGAAAAAGAAAAATAGAGG - Intronic
1118539559 14:66806836-66806858 AAAAGAAGACAGAAAAATGTGGG - Intronic
1118690453 14:68333959-68333981 AGAAGTAGACAGTAGAATGGTGG - Intronic
1119105712 14:71921668-71921690 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119513236 14:75228032-75228054 AAAAGAAAAGAAAAGAAAGGGGG + Intergenic
1119610862 14:76060853-76060875 AAAAGGAAAGAAAAGAAGGAAGG - Intronic
1119707504 14:76793408-76793430 AAAAGGAAAGAGGAGAGGGGAGG + Intronic
1119993444 14:79225917-79225939 ACAAAGAAGCAGAAGAATGCAGG - Intronic
1120067861 14:80065658-80065680 AAAAGTAGACAGTAGAATGGTGG + Intergenic
1120104756 14:80480994-80481016 AGAAGGAAACAGGAAAATGTGGG - Intronic
1120161858 14:81154306-81154328 ACAAGGAAACAAATCAATGGTGG - Intergenic
1120182759 14:81362443-81362465 AGAAGTAAAAAGTAGAATGGTGG + Intronic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120597978 14:86464783-86464805 AGAAGGAAAGAGAAGAAAGGGGG - Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1120664226 14:87286838-87286860 AAAAGCAATCAAAAGACTGGAGG - Intergenic
1121578723 14:95010396-95010418 AAAAAGAAACAGAGGGAAGGAGG + Intergenic
1121606764 14:95246372-95246394 AAAAGGAGAGAGAAGAAAGATGG - Intronic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1121828397 14:97029184-97029206 AGAAGGAAAGAGAAGAAAGAGGG - Intergenic
1121836944 14:97101035-97101057 TAAAAGAAACAGGAAAATGGAGG + Intergenic
1121908426 14:97768155-97768177 AAAAAGAAACAAAACACTGGAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122745641 14:103895749-103895771 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1123031144 14:105451758-105451780 AAAAAGAAAAAGAAAAAGGGGGG - Intronic
1123441194 15:20293116-20293138 AAAAAGAAACAGAGAAAAGGTGG - Intergenic
1123508205 15:20967447-20967469 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123565425 15:21541194-21541216 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123601689 15:21978483-21978505 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123779548 15:23612735-23612757 AGAAGTAGAGAGAAGAATGGTGG + Intronic
1124035891 15:26053357-26053379 AAAAGGAAAAAGAAAGAGGGAGG + Intergenic
1124234703 15:27979481-27979503 AAAAGGAAGCAAAGAAATGGTGG - Intronic
1124791921 15:32735777-32735799 AAAAAAAAAAAGAAGAATGTGGG + Exonic
1124792850 15:32746217-32746239 AAAAGGGAACAGAATAGAGGTGG + Intergenic
1125335042 15:38618600-38618622 AAAAGGAAAGAGCAAAAGGGAGG + Intergenic
1125699598 15:41670398-41670420 AAAAGTAGAAAGTAGAATGGTGG + Intronic
1125766012 15:42137072-42137094 AAGAGGAACCACCAGAATGGTGG + Intergenic
1125785949 15:42318203-42318225 AACAGGGAACTGAAGAAAGGAGG - Intronic
1126028208 15:44469795-44469817 GTAAAGAAACAAAAGAATGGTGG + Intronic
1126226530 15:46277041-46277063 AAAAGGAAAGAGACCAAGGGAGG - Intergenic
1126243340 15:46472118-46472140 AGAAGGAATCAGAGGAATGATGG + Intergenic
1126316491 15:47375397-47375419 AAAAGAAAATAGAAAAATGGAGG - Intronic
1126518932 15:49566955-49566977 AAACAGAAACTAAAGAATGGGGG + Intronic
1126600993 15:50427379-50427401 GAAAGTAAACTGAAGAGTGGTGG + Intronic
1126738617 15:51755863-51755885 ATAAGCAAGCAGAAGAAAGGAGG + Intronic
1126838707 15:52694893-52694915 AAAAAAAAAAAGAATAATGGGGG - Intronic
1126867003 15:52947679-52947701 AAAAGGAAAAGGAAGTATTGAGG + Intergenic
1126928471 15:53619230-53619252 ACAAGGAAACAGGAAAATGTTGG - Intronic
1127038154 15:54942702-54942724 AAAAGGAAAAAGCAGGCTGGAGG - Intergenic
1127216701 15:56830845-56830867 AAAGGGAAAAAAAAGAATGGTGG + Intronic
1127477307 15:59346958-59346980 AAAAGCATAAAGATGAATGGAGG + Intronic
1128061306 15:64737489-64737511 AAAAAGAAAAAGAAAAATGCTGG + Intergenic
1128166886 15:65473330-65473352 AAAAAAAAAAAGAAGAATAGAGG + Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1128483817 15:68065292-68065314 AAAAGGAAAAATAAGGCTGGGGG + Intronic
1128679369 15:69636824-69636846 GAAAGGAACCAGAAGAATCAAGG + Intergenic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1128930359 15:71698877-71698899 AAAAGCAAAGAGTAGAGTGGTGG + Intronic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1128961872 15:72014810-72014832 AAAAGAAAAGAGAAGAAAAGAGG + Intronic
1129085380 15:73084331-73084353 AAATGCAGACAGCAGAATGGTGG - Intronic
1129149093 15:73676248-73676270 AAAAAGAAACAGAAAAATCAAGG + Intergenic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129562964 15:76591191-76591213 AAAAAGAAAAAGAAAAATGCAGG + Intronic
1129568839 15:76656220-76656242 AACAGGAAACAGAAAAAAGCAGG + Intronic
1129698742 15:77755386-77755408 ATGAGGAAACTGAAGCATGGAGG + Intronic
1129714769 15:77840569-77840591 AAAGGGAAAGAGAAAAAGGGAGG - Intergenic
1129829159 15:78656741-78656763 TAAGGGAATCAGAAGAAGGGAGG - Intronic
1129853007 15:78805552-78805574 GAAAGGAAACACAAGCATGATGG - Intronic
1130079765 15:80722542-80722564 AAAAGGAAAAAAAAAAAGGGTGG - Intronic
1130249955 15:82293495-82293517 GAAAGGAAACACAAGCATGATGG + Intergenic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130819940 15:87484414-87484436 AAAAAGAAAAAGAAGAATGTGGG + Intergenic
1130894923 15:88162511-88162533 GAAAGAAAACAGGAGCATGGAGG + Intronic
1131176996 15:90215982-90216004 AAAAGAAAAAAAAAAAATGGAGG - Intronic
1131394005 15:92072184-92072206 AAAACCAAAAAAAAGAATGGTGG - Intronic
1131413626 15:92232371-92232393 AAAAGGGAACAGAAACGTGGCGG + Intergenic
1131504579 15:93005310-93005332 AAAAGGTAACAGGAGAAGAGGGG + Intronic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131673765 15:94650010-94650032 AAAAGGAAAAAGAAAGATGTAGG - Intergenic
1131682227 15:94736225-94736247 AAAAGAAAAGAAAAAAATGGTGG - Intergenic
1131715790 15:95109563-95109585 AAAAGAAAAGAAAAGAATGCAGG - Intergenic
1131939747 15:97547820-97547842 AAAAGAAAACAGAAGAAAACAGG - Intergenic
1131973004 15:97911232-97911254 AAAGGAACACAGAAAAATGGAGG - Intergenic
1132023467 15:98384573-98384595 AAAAGCAGGCAGAAGAATTGTGG + Intergenic
1132042588 15:98537495-98537517 AAAAGGCAACAGAGAACTGGGGG + Intergenic
1132439442 15:101844344-101844366 AAAAGAAAAAAAAAGCATGGTGG + Intergenic
1202973797 15_KI270727v1_random:268284-268306 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1132571033 16:644073-644095 AAAAAGAAACAGAGGGAAGGTGG - Intronic
1132651671 16:1023985-1024007 ACAAGGAAACTGAGGCATGGAGG - Intergenic
1132792626 16:1700711-1700733 GAAAGGAAACAGTTTAATGGTGG + Exonic
1132911261 16:2313562-2313584 AAAAAAAAAAAGAAGAAAGGGGG + Intronic
1132980652 16:2737304-2737326 AAAAGGCAACAAAAGGAGGGAGG + Intergenic
1133047676 16:3098086-3098108 AAAAGAAAAAAAAAGAGTGGGGG + Intronic
1133562852 16:6965851-6965873 ATAAGGAAACTGAGGCATGGGGG + Intronic
1133580408 16:7139231-7139253 AAAAAGAAAGAGAAGAGAGGAGG - Intronic
1133635057 16:7657284-7657306 AAAAGGAAATGGATGAATGTAGG - Intronic
1133949049 16:10374786-10374808 AAAAGGTAATGGAAGAATTGAGG - Intronic
1134152503 16:11816159-11816181 AAAAGGAAAAAAAAAAATGCCGG - Intergenic
1134185980 16:12085323-12085345 AAAAGGAAAGGGAAGAAGAGTGG - Intronic
1134337891 16:13318318-13318340 AAAAAGAAAAAAAAAAATGGAGG - Intergenic
1134463555 16:14451594-14451616 AAAAAAATTCAGAAGAATGGTGG + Intronic
1134535592 16:15024398-15024420 AAAAATAAACAGAAGAATTGGGG - Intronic
1134557413 16:15177384-15177406 AAAAGGAAAGAGAGGGAGGGAGG + Intergenic
1134757617 16:16682241-16682263 CAAATGAACCAGAAGAAAGGAGG - Intergenic
1134883020 16:17763034-17763056 GAATAGAAAAAGAAGAATGGAGG + Intergenic
1134917983 16:18089063-18089085 AAAAGGAAAGAGAGGGAGGGAGG + Intergenic
1135031461 16:19042165-19042187 AAATGGAAAGAAAAGAATGGGGG - Intronic
1135547850 16:23377729-23377751 AGAAGGAAACAGAAGTGGGGAGG - Intronic
1135551982 16:23405499-23405521 AAAAGGAAAAAAGAGAATGTGGG - Intronic
1135693893 16:24569742-24569764 AAAACCAAACGGAAGAATGATGG + Exonic
1135820748 16:25683377-25683399 AAAAAGAAAAAGAAAAATAGAGG + Intergenic
1136017900 16:27417123-27417145 AAAAGGAAAGAAAACAATTGCGG - Intronic
1136390030 16:29958184-29958206 AAAAAGAAACAAAAAAAAGGTGG + Intronic
1136546909 16:30959735-30959757 AAAAAGAAGAAGAAGAATGAAGG - Intronic
1136627015 16:31467495-31467517 AAAAGGGAGCCAAAGAATGGGGG - Intergenic
1137013726 16:35351149-35351171 AGAAGGAGAGAGTAGAATGGTGG + Intergenic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1137407266 16:48199436-48199458 AAAAAGAAACAGAAGAAGAAGGG + Intronic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1137965126 16:52924297-52924319 AGAAGGAGAGAGTAGAATGGTGG - Intergenic
1138075611 16:54039413-54039435 AGAAGGAAACATAGGGATGGAGG + Intronic
1138195827 16:55051491-55051513 AAAAGAAAAATGAAGAAAGGAGG + Intergenic
1138409848 16:56830343-56830365 ACAAGGAAACTGAGGCATGGAGG - Intronic
1138579430 16:57930823-57930845 AGAATGAAAAAGTAGAATGGTGG + Intronic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1139084557 16:63568693-63568715 AAGATGAAACAGAAGTAAGGTGG + Intergenic
1139241445 16:65396491-65396513 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
1139338126 16:66247689-66247711 AAGAGGAAACAGAGGCGTGGAGG + Intergenic
1139741244 16:69036972-69036994 AAAAAGAAAAAGAAGAAGGCTGG + Intronic
1139819172 16:69706772-69706794 CAAAGGAAATTGAGGAATGGAGG - Intergenic
1139860449 16:70016379-70016401 AAAAATAAACAGAAGAATTGGGG + Intergenic
1139876932 16:70153756-70153778 AAATGAAAACATAATAATGGTGG + Intronic
1140000234 16:71017619-71017641 AAAATCAAAGAGTAGAATGGTGG + Intronic
1140117726 16:72057284-72057306 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
1140119961 16:72075037-72075059 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
1140399177 16:74656476-74656498 AAAAGAAAAAAAAAGAATGGTGG - Intronic
1140814162 16:78605029-78605051 AAAAGGAAAGAAAAGAAGGGAGG - Intronic
1141013436 16:80425032-80425054 AAAAGCAAAGAGAAGAACAGGGG + Intergenic
1141772681 16:86100799-86100821 ATAGGGAAACAGAAAAAGGGTGG + Intergenic
1141873281 16:86804320-86804342 AAAAAGAAGAAGAAGAAGGGAGG + Intergenic
1142768535 17:2080110-2080132 AAAACAAAACAAAAGAATGATGG + Intronic
1143021778 17:3920501-3920523 AAAAAGAAACAGAAAAAAAGAGG - Intergenic
1143075288 17:4337357-4337379 AAAAGGAAAAAGAAGGCTGGGGG + Intronic
1143667505 17:8372908-8372930 AAAAAGAAAAAAAAGAATGAAGG + Intronic
1143744365 17:8980350-8980372 AAAAAGAAACAGAAAAAGTGGGG + Intergenic
1143993771 17:10989247-10989269 AAAAGGAAAAAGAAAAAAAGGGG + Intergenic
1144212318 17:13025912-13025934 GAAAGGAAAAAGAGGAAGGGAGG - Intergenic
1144829943 17:18125722-18125744 AAAAAAAAAAAAAAGAATGGTGG + Intronic
1145016819 17:19404287-19404309 AAAAAGAAAGAAATGAATGGTGG + Intergenic
1145700592 17:26826784-26826806 AAAAGGAATAGAAAGAATGGAGG + Intergenic
1145930608 17:28682703-28682725 TAAAGCAAACAGAAGAGTGAAGG - Intronic
1146266723 17:31457836-31457858 AAAAGGAGAGAGAGGAAGGGAGG - Intronic
1146848307 17:36199296-36199318 AAAAGGAATCACGAGTATGGAGG - Intronic
1146947272 17:36882447-36882469 AAAAGGAAAAAGAAAAAAGGGGG - Intergenic
1147158131 17:38555324-38555346 AAAAGGAGAAAGGAGCATGGAGG - Intronic
1147417644 17:40305008-40305030 AAAAGGAAAAAAAAAAATGCTGG + Intergenic
1147471172 17:40663138-40663160 AGAAGAAAACAGAAAAATGCTGG + Intronic
1147517649 17:41136540-41136562 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1147602789 17:41756219-41756241 AAAAGGAGAGAGAAACATGGAGG + Intronic
1147694323 17:42339862-42339884 AAAAAGAAAAAGAAGAAAGAAGG + Intronic
1148014262 17:44509993-44510015 AAAAAAAAAGAGAAGAAGGGAGG + Intergenic
1148113663 17:45162146-45162168 AAAGGGAAACAGGAGAAAAGGGG - Intronic
1148116830 17:45180699-45180721 AAAATGGAAAAGTAGAATGGTGG - Intergenic
1148116934 17:45181475-45181497 AAAATGGAAAAGTAGAATGGTGG - Intergenic
1148522703 17:48296378-48296400 AAAAGGAAAATGAAGCAAGGTGG + Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1148591947 17:48823058-48823080 AAAAAAAAAAAGAAGAGTGGGGG - Intergenic
1149435906 17:56633178-56633200 AAGGGGAGGCAGAAGAATGGTGG - Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1149933584 17:60780938-60780960 AAAATAAAACAGAACCATGGTGG - Intronic
1150202302 17:63370164-63370186 AAAAGAAAAAAAAAGAAAGGAGG - Intronic
1150239063 17:63617479-63617501 AAAAAAAAAAAAAAGAATGGAGG + Intergenic
1150431470 17:65121819-65121841 AAAAGGAAAGAGAGGGAGGGAGG - Intergenic
1150431862 17:65124742-65124764 AAAAGGAAAGAAAGGAAAGGTGG - Intergenic
1150472759 17:65451128-65451150 AGAAGGAAACAGCAGAGAGGAGG + Intergenic
1150651245 17:67011793-67011815 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1151450302 17:74194668-74194690 AGAAGAAAACAGAAGAAAGAAGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152253692 17:79225283-79225305 AAAAAAAAAAAAAAGAATGGAGG - Intronic
1152651632 17:81496849-81496871 AAAAAGAAAAAAAAAAATGGAGG + Intergenic
1153066815 18:1055083-1055105 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
1153294230 18:3530414-3530436 AAAAGAAAACCAAAGAAAGGAGG + Intronic
1153455100 18:5271979-5272001 AAAAGAAAACAGGAAAATGTGGG - Intergenic
1153758258 18:8305187-8305209 AACAGGAGACTGAAGAATGGTGG - Intronic
1154128369 18:11714333-11714355 AAAAGGAAAGAGCAGACAGGAGG + Intronic
1154928226 18:20961800-20961822 AAAAGGAAAAAGAAAAATGTTGG - Intronic
1154950215 18:21202645-21202667 TAAACGAAAGAGGAGAATGGGGG - Intergenic
1155076833 18:22365025-22365047 AAAAGGAGAGAGTAGAATGGTGG - Intergenic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155374255 18:25138746-25138768 AAAAGGAAACTGAGGAACTGAGG + Intronic
1155452954 18:25981885-25981907 AAAAAGAAAAAGAAAAAGGGAGG + Intergenic
1155522701 18:26685184-26685206 CAAGGGAGAGAGAAGAATGGTGG + Intergenic
1155593774 18:27458431-27458453 AAAAGGAAAGAGTAAAAAGGAGG + Intergenic
1155837582 18:30605380-30605402 AAAAGGAGAGAGAAGAATCTTGG - Intergenic
1155875914 18:31088338-31088360 GAAATGAAACAAATGAATGGTGG + Intronic
1155878649 18:31117352-31117374 AAAAGGAAAAAAATGAAAGGAGG - Intergenic
1156028654 18:32687418-32687440 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1156068709 18:33177412-33177434 GAAAGGATAGAGAAGAAAGGTGG - Intronic
1156379815 18:36547641-36547663 AAAAGGGAACAGAACACGGGAGG + Intronic
1156579614 18:38359737-38359759 AAAATGAATTAGAACAATGGTGG - Intergenic
1156868933 18:41921712-41921734 AAAAGGGAAAAGAAGACTGTGGG + Intergenic
1157089761 18:44623831-44623853 GAAAAGAAATAGAAAAATGGAGG + Intergenic
1157268321 18:46248523-46248545 AAAAGGAAAAAGCAGTAAGGAGG - Intronic
1157408403 18:47443297-47443319 TCAAGGAATCAGAAGAATGATGG + Intergenic
1157638970 18:49192862-49192884 AGAAGTAGACAGTAGAATGGTGG + Intronic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1157941723 18:51935955-51935977 AACAGGAGTCAGGAGAATGGAGG + Intergenic
1158032636 18:52985203-52985225 AAAAGGAAACCCAAGCATGGAGG - Intronic
1158080885 18:53589354-53589376 AAAAAGGAAAACAAGAATGGTGG - Intergenic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158353068 18:56583882-56583904 AAAAAGAAAAAGAAAAAAGGAGG + Intergenic
1158422535 18:57308373-57308395 AGAAGCAAACAGTAGAATGGTGG + Intergenic
1158552101 18:58445124-58445146 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
1158696469 18:59708514-59708536 AAAAAAAAAAAGAAGAAAGGCGG - Intergenic
1158729613 18:60008684-60008706 AAAAGGTAACTTTAGAATGGAGG - Intergenic
1158801180 18:60911354-60911376 AAATACAAACAGAACAATGGTGG + Intergenic
1159006649 18:63019441-63019463 AAAAGGAATGAGTAGAATGCAGG + Intergenic
1159088732 18:63822668-63822690 AAGAGGAAGTAGAAGAAAGGAGG - Intergenic
1159122606 18:64188054-64188076 AAAAGGAAAGAAAAGAACGATGG - Intergenic
1159309806 18:66692157-66692179 AAAAAGAAACAAAAGGAGGGTGG - Intergenic
1159377947 18:67618453-67618475 TTAAGGGAACAGAAGCATGGGGG - Intergenic
1159584299 18:70268721-70268743 AAAAGGAAAAGCAAGAATGAGGG - Intergenic
1159695521 18:71552405-71552427 AGAAGGAAACAGAAAGATGATGG + Intergenic
1160368838 18:78353612-78353634 AAAAGGAATCAGAGGAAAGATGG - Intergenic
1160591200 18:79945566-79945588 AGAGGCAAACAGAAGAAGGGAGG + Intronic
1160948826 19:1656015-1656037 AAATGGAAACAGAAATCTGGAGG - Intergenic
1161257549 19:3317826-3317848 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1161817260 19:6507070-6507092 AAAAGAAAAAAGAAGCATAGGGG - Intergenic
1161900426 19:7114691-7114713 AAAAATAAACAGGTGAATGGGGG - Intronic
1161909712 19:7184062-7184084 AAAAAAAAAAAAAAGAATGGTGG + Intronic
1161930539 19:7336673-7336695 AAATGCAAATAGATGAATGGAGG + Intergenic
1161958140 19:7507583-7507605 AAAAGGAAAAAAAAAAATAGAGG + Intronic
1162176821 19:8836481-8836503 AAAAGAAAAAAGAAGAAAGAAGG - Intronic
1162251158 19:9444693-9444715 AAAAAGAAAGAGAAGAAGGAAGG + Intergenic
1162721680 19:12666583-12666605 AAAAGGAAAAAGCAGAGAGGCGG + Exonic
1162826539 19:13255792-13255814 AAAAGGAAAGTGAAGGAGGGAGG - Intronic
1163127334 19:15251421-15251443 AAATGGAAACACAAGAACGGGGG + Intronic
1163570626 19:18080030-18080052 AAAAGAAAAGAAAAGAATGAAGG - Intronic
1163705323 19:18809052-18809074 GAAAGGAAAAAGAAAAATAGAGG + Intergenic
1164453874 19:28390773-28390795 TAAGGGGAACAGAAGAGTGGGGG + Intergenic
1164462362 19:28459846-28459868 AAAAGGAAAGAAAAGAAAGAAGG + Intergenic
1164610731 19:29629851-29629873 AAAAGAAAAAAGAAAAATGAAGG + Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164730906 19:30503786-30503808 AAAAGGAATCAGAAAAATAGAGG - Intronic
1164737367 19:30551756-30551778 AAGAGGACACAGAAGAAATGGGG - Intronic
1164923960 19:32111367-32111389 AAAAGGAAAGAAAAGAAGAGTGG + Intergenic
1165034623 19:33023805-33023827 AAAAGAAAACAGAAGAGCGCAGG + Intronic
1165188628 19:34043252-34043274 AAAGGGAAAGAGAGAAATGGGGG - Intergenic
1165382810 19:35493169-35493191 AAAATGAAAACGAAGAATGAAGG + Intronic
1165805124 19:38575808-38575830 AAAAGGAAAAAGAAAAACAGTGG + Intronic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166024639 19:40070407-40070429 TCAAAGAAACAGAAGATTGGTGG - Intronic
1166165291 19:40983630-40983652 AAAAGCAAAGAGTAGAATGGGGG + Intergenic
1166379386 19:42347772-42347794 AAAAAAAAAAAGAAGAATGAAGG - Intronic
1166472746 19:43093877-43093899 AAAAGGAAAAAGGAAACTGGAGG + Intronic
1166510780 19:43407510-43407532 AAAAGGAAAGAAAAGAAAGCCGG + Intronic
1166640421 19:44490149-44490171 AAAAGGAAATAGGAGAAGGGAGG + Intronic
1166881740 19:45934281-45934303 ACAGGGTAGCAGAAGAATGGGGG - Exonic
1167130992 19:47585707-47585729 AAAAGGAAAAAAAAGAAAAGAGG + Intergenic
1167197451 19:48040328-48040350 AAATGGAAACTGAAGAGTAGCGG + Intronic
1167205319 19:48097569-48097591 AAAAGAAAACAGAGGAGAGGAGG - Intronic
1167567340 19:50264913-50264935 GAAAGGAATGAGAAGGATGGAGG + Intronic
1167608777 19:50496196-50496218 AAAAAGAAAGAAAGGAATGGGGG + Intergenic
1167665411 19:50820534-50820556 AAAGGGAAAGAGAAAAATGTGGG + Intronic
1167720402 19:51175905-51175927 AATAGGAGACAGTAGAATGATGG - Intergenic
1167847423 19:52176060-52176082 AAAAGGAAAAAGAACAGTGAAGG - Intergenic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168506971 19:56944065-56944087 AAAAAGAAACTGATGAATGATGG - Intergenic
1168570229 19:57460913-57460935 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1168631716 19:57961936-57961958 AAAAGGAAAGAAAAGAAGGGAGG - Intronic
925233265 2:2254506-2254528 ATAAGGAGACAGGAGCATGGAGG - Intronic
925467954 2:4126869-4126891 AAAAGTAAAAAGAAGAACAGAGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
925974376 2:9131277-9131299 AAAAGGAAACAGAAGACATTTGG + Intergenic
926381609 2:12296196-12296218 AAAAGCAGGCAGAGGAATGGAGG + Intergenic
926442694 2:12906953-12906975 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
926460610 2:13125221-13125243 AGAAGGAAAGAAAAGAATGAAGG + Intergenic
926873032 2:17444284-17444306 AAAGGGAAAGAAAGGAATGGGGG + Intergenic
926875865 2:17478020-17478042 AAAAGAAAAGAAAAGAAAGGAGG + Intergenic
926937358 2:18099693-18099715 AGAAGGAAAGAGAAGAATCAAGG - Intronic
927078535 2:19604004-19604026 AGAAGCAGACAGTAGAATGGTGG - Intergenic
927534571 2:23844780-23844802 AAAAGGAAAGAGGAGACAGGAGG + Intronic
927659706 2:24982530-24982552 GAAAGGAAAGAAAAGAAAGGAGG + Intergenic
928510187 2:31995598-31995620 AAAAGGAAACAGAAAAAAAGGGG + Intronic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
928742672 2:34373290-34373312 AAAAGAAAAAGGAAGAAAGGCGG - Intergenic
928891426 2:36207940-36207962 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
928934179 2:36657452-36657474 GAAAGGAAAAAGCAGAATGGTGG + Intergenic
929071106 2:38031443-38031465 AAAAGGAAACAAAGCACTGGTGG - Intronic
929137429 2:38637972-38637994 AAAAGGAAAGAAAAGAAAGAAGG + Intergenic
929252847 2:39778921-39778943 ACAAGGAAAGAAAGGAATGGTGG + Intronic
929362637 2:41112732-41112754 AAAAGGCAAAAAAAAAATGGGGG - Intergenic
929367321 2:41175645-41175667 AAAAGGAAGAAGGAGAAAGGAGG + Intergenic
929794082 2:45045451-45045473 GAAAGGAAAAAGAATAAGGGAGG - Intergenic
929855558 2:45635928-45635950 AAAAAGAAGAAGAAGAAGGGTGG + Intergenic
929891787 2:45924371-45924393 AATAGGAAAATGAAGGATGGAGG + Intronic
929981005 2:46680242-46680264 AAGAGGAAAGAGAAGATTTGGGG + Intergenic
930284140 2:49406892-49406914 CAAAGGAAACAATAGAATGAAGG - Intergenic
930344029 2:50155430-50155452 AAAAAAAAAAAGAAGAAAGGAGG + Intronic
930385640 2:50691217-50691239 AAAAGTAAACAGAAAAATAAAGG + Intronic
930409092 2:51000894-51000916 ACATGGAAACAGAAAAGTGGAGG - Intronic
930410568 2:51020707-51020729 AAAATGAAACAGAACATTGATGG + Intronic
930448969 2:51510590-51510612 AAAAGGAAAAAAAAAAAGGGGGG + Intergenic
930514344 2:52387274-52387296 AAAAAAAAACAGAAGAATAGGGG - Intergenic
930622546 2:53658987-53659009 AAAAGGAAAGAGAAGAAGAGGGG + Intronic
930683708 2:54285380-54285402 AAATGGAAACAGAAGAGAAGTGG - Intronic
930695792 2:54410749-54410771 AAAAAAAAAAAAAAGAATGGGGG - Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
931077142 2:58728300-58728322 AAAAGGAAAGGGAAGAAGAGAGG - Intergenic
931090070 2:58876273-58876295 AAAGGAATACAGGAGAATGGTGG + Intergenic
931341216 2:61402386-61402408 AATAGGAAAGAGAAGAAGGAAGG + Intronic
931456442 2:62413230-62413252 AAAAGGAAAAAGAAAAAAGTTGG - Intergenic
931509643 2:62976838-62976860 AAAAGGAACTATAAGAAGGGAGG - Intronic
931646949 2:64432378-64432400 TGAAGGAGACAGCAGAATGGAGG - Intergenic
931684214 2:64779819-64779841 AAAAAGAAAAAGAAAAAGGGAGG - Intergenic
931992582 2:67805443-67805465 GAAAGAAAGCAGAAAAATGGGGG + Intergenic
932034416 2:68227759-68227781 AGAAGGAAAAACAGGAATGGGGG - Intronic
932155984 2:69418096-69418118 GAAAGAAAACTGAAGAATGGGGG + Intronic
932208209 2:69902921-69902943 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932518281 2:72377666-72377688 AGAAGTAGACAGCAGAATGGTGG + Intronic
932646455 2:73508190-73508212 AAAAAGAAGAAGAAGAAAGGAGG - Intronic
932833862 2:75016523-75016545 AGAAGCAAAGAGTAGAATGGTGG + Intergenic
932843773 2:75113514-75113536 AAAAGGAAGAAGAAAAAAGGAGG - Intronic
932869960 2:75388933-75388955 AAAAGGAAAAAGAAAAAAGAAGG + Intergenic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933067670 2:77818492-77818514 AAAAGGAAAGAAAAGGAGGGAGG - Intergenic
933149261 2:78894358-78894380 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
933209561 2:79551299-79551321 AAGAGGAAATGGAAAAATGGGGG + Intronic
933386703 2:81619949-81619971 AAATAGAAACAGAACAATGTAGG + Intergenic
933441260 2:82317423-82317445 ACAAGGAAACATAAGGATGATGG + Intergenic
933542912 2:83671261-83671283 AAAGGGGAACAAAAGAAAGGAGG + Intergenic
933619186 2:84517359-84517381 AAAGGGAAAAAAAAGAATTGAGG - Intronic
933640510 2:84754165-84754187 AAAAGAAAAAAAAAGAATGTTGG - Intronic
933669891 2:84997425-84997447 AAAAGCAAACAAAAGAATCATGG - Intronic
933751306 2:85603488-85603510 AAAAGGAAACAGGATAGTGTGGG + Intronic
933884659 2:86706893-86706915 AAATGAAAACAGAAAAAAGGGGG + Intronic
934982281 2:98852931-98852953 AAAAGGAGAGAGAAGAAGGAAGG + Intronic
935033957 2:99349972-99349994 AAAAGTAAAGAGTAGAATAGTGG - Intronic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
935491769 2:103729852-103729874 AAAAGAAAACAAAAGAAAGAAGG + Intergenic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935695278 2:105766116-105766138 TAAAGGAAACAAAAGAATGAGGG + Intronic
935793627 2:106617939-106617961 AGAAGCAGACAGTAGAATGGTGG + Intergenic
935851690 2:107228648-107228670 GAATAGGAACAGAAGAATGGTGG - Intergenic
935912983 2:107917498-107917520 AGAAGCAAAGAGAAGAATAGTGG + Intergenic
936584159 2:113738282-113738304 AGAAGGAAAGAGTAGAATGGTGG - Intronic
936941131 2:117885557-117885579 AAATAGAATCAGAAGAAGGGTGG - Intergenic
937129045 2:119493627-119493649 AAAAAAAAGAAGAAGAATGGAGG - Intronic
937240762 2:120460951-120460973 AAAAGGACGCAGAAGACAGGAGG - Intergenic
937380251 2:121370310-121370332 GAAAGAAAATCGAAGAATGGAGG - Intronic
937507130 2:122550209-122550231 AAACTGAATGAGAAGAATGGTGG + Intergenic
937620511 2:123979933-123979955 AGAAGGAAACAGAAAAAGGTGGG + Intergenic
937744073 2:125389893-125389915 AAAAAGAAAAAGAAAAATAGAGG - Intergenic
937842466 2:126537562-126537584 AAAAAGAAACAGAAAAAAGGAGG + Intergenic
937842944 2:126544192-126544214 AAAAGTAACCAGAAGAAAGCTGG + Intergenic
937863679 2:126732347-126732369 AAAAAGAAAAAGAAGAAGGAAGG + Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939012747 2:136865523-136865545 TCAAGGAATCAGAAGAATGTTGG - Intronic
939163904 2:138619732-138619754 AATAGGAATCAGAAGACTGAAGG - Intergenic
939174253 2:138731134-138731156 AAAAGCAAGCAGCACAATGGAGG - Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939384099 2:141474128-141474150 AAAAAGGAAAAGAAGAAAGGAGG - Intronic
939580196 2:143937730-143937752 AAAAGGAAACAGAACGCTGGGGG + Intergenic
939766883 2:146261858-146261880 AAAAAGAGAGAGGAGAATGGGGG - Intergenic
939825914 2:147015490-147015512 AAAAGAAAAGAAAAGAAGGGAGG + Intergenic
939976714 2:148725989-148726011 AAAAACAAAAAGCAGAATGGTGG - Intronic
940337784 2:152546938-152546960 AAAAAAAAAAAAAAGAATGGGGG - Intronic
940352897 2:152708403-152708425 AAAGGGTAACAGAACAATTGGGG + Intronic
940396795 2:153199016-153199038 AAAAGGGAAAAGAGGAATGAAGG - Intergenic
940524966 2:154801477-154801499 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
940628138 2:156202387-156202409 AAAAAGAAAAGGAAGAATGTGGG - Intergenic
940655437 2:156482254-156482276 AAAGGAAAACAGAAGAGTGTTGG - Intronic
940841744 2:158591126-158591148 AATAGGAAAAAGAAGAGAGGGGG + Intronic
940888937 2:159015929-159015951 AGAAGAAGACAGAAGAATGTGGG - Intronic
941122216 2:161543678-161543700 AAAAAGAAACTGTATAATGGAGG + Intronic
941123636 2:161560915-161560937 AAAAGGAGGCAGAAAAATGTGGG + Intronic
941214476 2:162688724-162688746 AAAAAAAAAAAAAAGAATGGGGG - Intronic
941262647 2:163317107-163317129 ACAAGGAAAAAGAGTAATGGTGG + Intergenic
941329860 2:164166768-164166790 AAAAGGAAGAAGAAGAAGAGGGG - Intergenic
941434501 2:165452468-165452490 AGAAGGAAAGAAAGGAATGGGGG - Intergenic
941595913 2:167476837-167476859 AAGAAGAAAAAGAAGAAAGGGGG + Intergenic
941760633 2:169238734-169238756 AAAAAGAAAAAGAAGAGAGGGGG - Intronic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
941869735 2:170371695-170371717 AAAAAAAAACAGAAAAATTGAGG + Intronic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
941936037 2:170982095-170982117 GAAGGGAGACAGAGGAATGGAGG + Intergenic
941976975 2:171415974-171415996 AAAGGGTAACAGGAGAATGTGGG + Intronic
942115625 2:172726464-172726486 GACAGGAAACAGGAGATTGGAGG - Intergenic
942266555 2:174233187-174233209 TCATGGAAACAGTAGAATGGTGG + Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942836706 2:180307587-180307609 AAAAGGAACCACAAGAATAAAGG + Intergenic
942875482 2:180790705-180790727 AAAAAGAAAAAGAAGAAAGAAGG - Intergenic
942972264 2:181971105-181971127 AAATGGAAACAGAAGAGTAAAGG - Intronic
943063597 2:183063856-183063878 AAAGGGAAACAAAAGAAAGAAGG - Intergenic
943435443 2:187859946-187859968 AAAAGGAATCACAAAACTGGAGG + Intergenic
943550916 2:189338516-189338538 GAAAAGAACCTGAAGAATGGGGG - Intergenic
943867022 2:192938260-192938282 AAAAGGAGAAAAAAGAATAGAGG - Intergenic
944123017 2:196261845-196261867 AAAAGGAAAAAGAAATATTGCGG - Intronic
944228704 2:197372397-197372419 AAAAGGAAAGAAAAGAAATGGGG - Intergenic
944263825 2:197702661-197702683 AAAAGGAAACAGCAGACTCTGGG - Intronic
944267681 2:197746915-197746937 AAAAGCAGAGAGAAGAATGGTGG + Intronic
944494808 2:200295884-200295906 AAAAGGAAACAGTAGATTTTGGG + Intergenic
945013244 2:205486924-205486946 AAAAGGAATGAAAAGAATGTAGG + Intronic
945026547 2:205625023-205625045 AGCAGGAGACAGCAGAATGGTGG + Intergenic
945263236 2:207864186-207864208 AAAAGTAAGTTGAAGAATGGTGG - Intronic
945367883 2:208978566-208978588 AAAAGGGAAAAGAAGTATGTTGG - Intergenic
945435812 2:209816451-209816473 AAAATGAAACAGAAAAAGAGAGG + Intronic
945465365 2:210163458-210163480 AAAAGGAAAGAGAACAAAGATGG + Intronic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945651030 2:212559468-212559490 AAAAGCAGAGAGTAGAATGGTGG + Intergenic
945807328 2:214505763-214505785 AAAGCAAAACATAAGAATGGTGG + Intronic
945850826 2:215004447-215004469 AGAAGAAAAGAGAAGATTGGGGG + Intronic
945931703 2:215861796-215861818 AAAAGGAAAGAAAAGAAGGAAGG - Intergenic
946045038 2:216813968-216813990 ACAATCAGACAGAAGAATGGGGG + Intergenic
946072168 2:217043779-217043801 AAATAAAAACAGAAAAATGGAGG - Intergenic
946274997 2:218624740-218624762 GAAAAGAAAAAAAAGAATGGAGG + Intronic
946303767 2:218843761-218843783 AAAAAGAAAAAGAAGAAAAGAGG + Intergenic
946857969 2:223972052-223972074 AAAGGTAAAGTGAAGAATGGCGG - Intergenic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
947020832 2:225673892-225673914 AAAGGGAAACAGAGGACTGTTGG - Intergenic
947196890 2:227577042-227577064 AAAAGGAAAAAGAAAAAAAGGGG - Intergenic
947251272 2:228107269-228107291 AAAAGTAGAGAGTAGAATGGTGG - Intronic
947313927 2:228834325-228834347 AAAAGCAAACAGAAAACTGAAGG + Intergenic
947317477 2:228877230-228877252 AAAAGGAGAGAGAAGAAAGAGGG + Intronic
947888425 2:233594702-233594724 AGAAGGAAACAGGAAAATGTGGG + Intergenic
948221996 2:236277402-236277424 AAAAGGAAAAAGAAGATTCTAGG + Intergenic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1169228251 20:3869593-3869615 AAAAGGAAAAAAAAAAGTGGTGG - Exonic
1169414465 20:5404129-5404151 AGAAGAAAACAGGAGAATGAGGG - Intergenic
1169644734 20:7797395-7797417 ACAAAGAAACAGAAAAATGTTGG - Intergenic
1169810471 20:9604490-9604512 ACAAGGACACTGAAGTATGGAGG + Intronic
1170046195 20:12087973-12087995 CTAAGGAAGCAGAAGAATGCTGG - Intergenic
1170267664 20:14485914-14485936 AAATGGAAACAGAAGAACAGGGG + Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170448692 20:16458658-16458680 AAAAGCAAAGGGAAGAAAGGAGG + Intronic
1170448882 20:16460673-16460695 AAAATGAAGATGAAGAATGGAGG + Intronic
1170482371 20:16779134-16779156 AAAAGGGAACAGAGAAATGAGGG + Intergenic
1170689146 20:18596445-18596467 AAATGTGAACAGAAGAAGGGAGG - Intronic
1170705136 20:18737940-18737962 AGAGGGCAACAGCAGAATGGTGG + Intronic
1171169582 20:23003489-23003511 AAAAGGAAACAGAAACAGAGAGG + Intergenic
1171239953 20:23558494-23558516 AACAGAAATCAGAAGAAAGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171350982 20:24503126-24503148 AGAAGGAATGAGAAGAATGAGGG - Intronic
1171441005 20:25162918-25162940 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1171566479 20:26195800-26195822 ATATAGAAACAGTAGAATGGTGG + Intergenic
1171724920 20:28607702-28607724 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1171753153 20:29075349-29075371 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1171858420 20:30372291-30372313 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1172034803 20:32003156-32003178 AAAAGGAAACAGAAGAGGACAGG - Exonic
1172036860 20:32017266-32017288 AAATGGAAAGGGAAGAATGTTGG - Intronic
1172097138 20:32465972-32465994 AAAAAAAAAAAAAAGAATGGAGG - Intronic
1172133456 20:32671856-32671878 AAAAAAAAATAGTAGAATGGGGG + Intergenic
1172532490 20:35642563-35642585 AAAAGGAAAAAGAAGAGTGGTGG - Intronic
1172652561 20:36514357-36514379 ACAAGGAAGCAGAGAAATGGAGG + Intronic
1172681687 20:36720750-36720772 AAAAGAAAAAAGAAGTATGAGGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173023865 20:39289783-39289805 AAAGGGAAAGAGCAGAAGGGAGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173705509 20:45107612-45107634 AAAAAAAAAAAAAAGAATGGTGG + Intergenic
1173922383 20:46756188-46756210 AAAAAGAAACAGACGATTGATGG - Intergenic
1173988333 20:47280130-47280152 AAAAAAAAAAAAAAGAATGGTGG + Intronic
1174181330 20:48676778-48676800 AAAAGGAAAGGAAAGAATGGAGG - Intronic
1174265135 20:49325786-49325808 GAAAGGAAACAGAAAGAGGGAGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174619528 20:51863522-51863544 AAAAAGAAAAAGAAAAATGGTGG - Intergenic
1175512714 20:59543734-59543756 ACAAGGAAACGGAACAATAGGGG - Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176155526 20:63618186-63618208 CAAAGGAAAAAGGAGAATGGAGG + Intronic
1176891406 21:14324151-14324173 AAAAGAAAAGAGTAGAAAGGAGG + Intergenic
1176895849 21:14377707-14377729 AAAAGCAGGCAGAAGAATGTCGG + Intronic
1177041798 21:16121758-16121780 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
1177107638 21:16979696-16979718 AAAAGGAATCAGCAGAACTGTGG + Intergenic
1177197699 21:17920095-17920117 AGAAGAAAACAGAAAAATGTGGG - Intronic
1177248255 21:18559060-18559082 AGTAGAAAACAGAAGAATGTTGG - Intergenic
1177587824 21:23120887-23120909 AAAGGGCAGCAGAAGAATGGTGG + Intergenic
1177664428 21:24135662-24135684 AAAAGGAGAGAAAAGAAAGGAGG - Intergenic
1177689041 21:24479746-24479768 AAAAGCAGAAAGAGGAATGGTGG + Intergenic
1177767248 21:25473013-25473035 AGAAGAAAACAGAAAAATGTGGG + Intergenic
1177806976 21:25884180-25884202 AAATGGAAACGTAAGAATCGGGG - Intronic
1178116726 21:29425516-29425538 AAGAAGAAACAGAAGTGTGGGGG + Intronic
1178339854 21:31777092-31777114 AAAAGCAGGCAGAAGAATGTGGG + Intergenic
1178445454 21:32637388-32637410 AAAAGAAAAAAGAAAAATTGAGG - Intronic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1179096683 21:38322440-38322462 AAAAGACATCTGAAGAATGGTGG - Intergenic
1179331523 21:40406950-40406972 AAAAGCAGAGAGTAGAATGGTGG + Intronic
1179663817 21:42895668-42895690 AAAAGAAAAAAGAAGAAACGTGG + Intronic
1179680414 21:43016792-43016814 AAAAGGAAAGAGAAGCTTGAGGG - Intronic
1179897979 21:44373699-44373721 AAAAGGAAAGAGAGAAATTGAGG - Intronic
1180298470 22:10966394-10966416 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1180409942 22:12597412-12597434 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1180489767 22:15832455-15832477 AACTGGATACAGCAGAATGGCGG + Intergenic
1180567633 22:16688431-16688453 AGAAGCAAAAAGCAGAATGGTGG + Intergenic
1180638055 22:17276410-17276432 AAAAGAAAAGAGAAGAGGGGAGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1180912418 22:19460747-19460769 AAAAAAAAAAAAAAGAATGGTGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181156755 22:20927123-20927145 AAAAAAAAAAAAAAGAATGGTGG + Intronic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181889407 22:26048574-26048596 AAAAGGAAGCCATAGAATGGTGG - Intergenic
1182114114 22:27745127-27745149 AAAAAAAAAAAGAAAAATGGAGG + Intergenic
1182706682 22:32286358-32286380 AAAGGGAAACAGAATAAAGGAGG - Intergenic
1182925774 22:34123220-34123242 AAAAAGAAAGAGTAGAATGTAGG - Intergenic
1182963492 22:34499431-34499453 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1183780984 22:39998660-39998682 ACAAGTAAACAGCTGAATGGCGG - Intronic
1183997734 22:41648066-41648088 GAAAAGAAACAGAAGAGAGGAGG - Intronic
1184368302 22:44066837-44066859 AAAAGGAAGAAGAAGAGAGGAGG - Intronic
1184394990 22:44229434-44229456 AAAGGGAAACAGAATAAAAGAGG - Intergenic
1184635146 22:45822087-45822109 GACAGGAAACAAAAGAATGCAGG - Intronic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1184999376 22:48235014-48235036 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1185123812 22:48992659-48992681 AGAAGTAGAGAGAAGAATGGTGG + Intergenic
1185355464 22:50366894-50366916 AAAAGGAAACAAAAGACAGGAGG - Intronic
1185360138 22:50401631-50401653 AAAAGAAAAAAGAAAAAGGGAGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949283931 3:2379248-2379270 AAAAGGAAACGGAAAAAGGTAGG - Intronic
949670041 3:6389029-6389051 AAAAGGAAGGAGATGAGTGGAGG + Intergenic
949675571 3:6449172-6449194 ACAAGGAAACAGAAGAATTAGGG + Intergenic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
950260979 3:11543374-11543396 AGAAGGAAACAGAACTGTGGGGG - Intronic
950398895 3:12755098-12755120 AAAAGAAAAAAGAAAAAAGGAGG - Intronic
951064214 3:18245470-18245492 ACAAGGAATCAGAAAAATGTAGG - Intronic
951328035 3:21329015-21329037 AAAAGAAAAAAAAAAAATGGAGG + Intergenic
951353059 3:21630188-21630210 AAAAAGAAAGAAAAGAAAGGTGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951490192 3:23261649-23261671 AAAAGCAGAGAGTAGAATGGTGG - Intronic
951490391 3:23264366-23264388 AAAAGGAAAAAAAAAAAAGGTGG + Intronic
951651895 3:24959754-24959776 AAAAGAAAAGAGAGGAAGGGAGG + Intergenic
951671959 3:25193770-25193792 AAAAGGAAAAAGGGAAATGGAGG + Intronic
951790815 3:26482184-26482206 AAAATGAAACACAAAAATTGAGG - Intergenic
951873878 3:27398366-27398388 AGAAAGAAAAAGCAGAATGGGGG + Intronic
952135964 3:30420051-30420073 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
952225519 3:31371584-31371606 AGAAGGACACAGAATAGTGGAGG - Intergenic
952367707 3:32689370-32689392 AAAAAGAAAAAAAAGAATAGAGG + Intronic
952536692 3:34318500-34318522 AAAAGCAAACAGAAATAAGGAGG - Intergenic
952547898 3:34441381-34441403 AAAAGCAGAGAGCAGAATGGTGG - Intergenic
952609957 3:35196709-35196731 AAGAAGAAACAGAGGAAAGGAGG - Intergenic
953204988 3:40818427-40818449 ACAAGGTAACAGAAGCAAGGTGG - Intergenic
953237628 3:41120211-41120233 AAACAGAAACAGAAGGAAGGAGG - Intergenic
953271229 3:41447307-41447329 AAAAGAAGACAGGAGAATGCTGG + Intronic
953276287 3:41501877-41501899 AGAAGCAAACAGGAGAATGGTGG - Intronic
953896128 3:46803808-46803830 AAAAGGTAAAAGGAAAATGGTGG - Intronic
953950357 3:47184795-47184817 AAAAGAAAAGAAAAGAAAGGGGG - Intergenic
953986396 3:47446473-47446495 AAAAGTAAACATAAGAATTGAGG - Intronic
954099676 3:48359913-48359935 AAAAGCAAAGAGTAGAATGTTGG + Intergenic
954202205 3:49030359-49030381 AAAAAGAAAAAAAAAAATGGAGG + Exonic
954543595 3:51413913-51413935 AAAAGGAAAGAGAATAATGAAGG + Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955328702 3:58029447-58029469 AAAACCCAACAGAAGAAAGGGGG - Intronic
955420750 3:58734701-58734723 GAAAGGGAAAGGAAGAATGGAGG - Intronic
955671810 3:61410274-61410296 AAAAGGAGAAAGAAGGAGGGAGG + Intergenic
955731872 3:61995760-61995782 AAAAAGAAAAAGAAGGAGGGAGG - Intronic
955885699 3:63596257-63596279 GAAAGGGAAGAGAAGAAGGGGGG - Intronic
955978887 3:64504688-64504710 AAAAGGAAAAAGAAGAAATATGG - Intergenic
956209323 3:66786986-66787008 AAAAAGAAAAAGAAAGATGGAGG - Intergenic
956318856 3:67972461-67972483 AGAAGCAGACAGTAGAATGGTGG + Intergenic
956390058 3:68762214-68762236 AAAATGTAGCAGAAGAATGGAGG + Intronic
956814962 3:72899884-72899906 AGAAGGAAACAGAAATATGTGGG - Intronic
956901201 3:73717690-73717712 AAGAGGACAGAGAACAATGGAGG - Intergenic
957111675 3:75968761-75968783 ATATAGAAACAGTAGAATGGTGG - Intronic
957111678 3:75968827-75968849 ATATAGAAACAGTAGAATGGTGG - Intronic
957111681 3:75968894-75968916 ATATAGAAACAGTAGAATGGTGG - Intronic
957111684 3:75968960-75968982 ATATAGAAACAGTAGAATGGTGG - Intronic
957125072 3:76148490-76148512 AAAAGGGAGCAGACGAATGGAGG - Intronic
957191111 3:77010925-77010947 GGAAGGAAAGAGAAGAAAGGGGG - Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957240384 3:77653412-77653434 AAGAGGGAACAGACAAATGGTGG + Intergenic
957276514 3:78097196-78097218 AAAAGGAAAAAGACAAAAGGAGG + Intergenic
957478993 3:80767051-80767073 AAAAGAAAAAAAAAGATTGGGGG + Intergenic
957520402 3:81311594-81311616 AAAAGAAAAAAGAAAAAGGGAGG + Intergenic
957875932 3:86146742-86146764 AGAAGGAGAGAGTAGAATGGTGG - Intergenic
957975965 3:87445383-87445405 AAAAGGAAAAACAAGAAGGAAGG - Intergenic
958079753 3:88731676-88731698 ACAAGGAAACAGCAGTTTGGGGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958545777 3:95548562-95548584 AAAAGAAAAAAAAAGAATGATGG + Intergenic
958604276 3:96338236-96338258 AGAAGAAAACAGAAAAATGAGGG + Intergenic
958655258 3:96993290-96993312 AAAAAAAAAAAAAAGAATGGGGG - Intronic
958777877 3:98507391-98507413 AAAAAAAAAGAGATGAATGGAGG - Intronic
959404352 3:105941996-105942018 AAGAAGAAAGGGAAGAATGGAGG - Intergenic
959576424 3:107939222-107939244 TCAAGAAAACAGAAGAATAGGGG - Intergenic
959730807 3:109599519-109599541 AAATGGCACCAGAATAATGGAGG + Intergenic
959795291 3:110420328-110420350 AAAAGGAAAGAAAGGAAGGGAGG + Intergenic
959817909 3:110697602-110697624 GAAAAGAGAAAGAAGAATGGAGG + Intergenic
959885780 3:111497813-111497835 AAAAGGAAACAGCGGAAGAGTGG - Intronic
960099377 3:113723913-113723935 AAAAAGAAAGAAAAGAAGGGAGG + Intronic
960114160 3:113876856-113876878 AAAAGGAAAGAGAAAAAAAGAGG + Intronic
960125800 3:113997161-113997183 ATAAGTAAACAGATGAATTGTGG + Intronic
960455933 3:117872214-117872236 AAAACAAAACTGAAGAATGTAGG + Intergenic
960460326 3:117926335-117926357 AAAAGCAGAGAGCAGAATGGTGG + Intergenic
960601783 3:119466089-119466111 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
960609657 3:119543876-119543898 AAAAAAAAAAAGAACAATGGAGG - Intronic
960623961 3:119662156-119662178 AAAAGGAAGGAGAAGAAAGAAGG + Intronic
960708943 3:120507817-120507839 AAAAGGAAAAAGAAAAAAGAAGG - Intergenic
960865462 3:122194961-122194983 AAAAGTAAGAAGAAGAAAGGAGG - Intronic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961195893 3:125001154-125001176 AAACAAAACCAGAAGAATGGAGG - Intronic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
961690988 3:128669388-128669410 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
962030787 3:131598233-131598255 AGTAGGAAACTGAAGTATGGAGG - Intronic
962701232 3:138001371-138001393 AAAAAAAAAAAAAAGAATGGGGG - Intronic
962894395 3:139700840-139700862 AAGAGAGAACAGAAGATTGGTGG + Intergenic
963006422 3:140730065-140730087 AAAAGGAAAAACAATTATGGAGG + Intergenic
963140473 3:141942466-141942488 AAAAAAAAAAAGAAGAAGGGTGG - Intergenic
963256672 3:143151976-143151998 AAAATGAAACTGGAGACTGGGGG - Intergenic
963276655 3:143337960-143337982 AAAAGGTAAAAGAAGAAAGGAGG + Intronic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963431287 3:145207688-145207710 AAAAAGAAAAAGAAGGAGGGAGG + Intergenic
963595889 3:147324199-147324221 AAAAAGAAAGAGAAGAAGTGAGG + Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963683526 3:148410313-148410335 AAAAGAAAAGAAAAGAATTGGGG - Intergenic
963714679 3:148789390-148789412 AAAAGGAAACAGAGGAGGCGAGG + Intergenic
964248939 3:154687433-154687455 AAAAAGAAAAAGAAAAAAGGGGG + Intergenic
964408192 3:156371643-156371665 AAAAGAAACCAGAGGAATTGGGG + Intronic
964432175 3:156618915-156618937 AAAAAGAAAAAAAAGAATGAGGG - Intergenic
964598129 3:158460978-158461000 AGAAGCAAAGAGAAGAAAGGAGG + Exonic
964847133 3:161056327-161056349 AAAAGGACTCAGAGGAATAGTGG - Intronic
964910673 3:161776549-161776571 AAAAGAAAACAGGAAAATGCGGG + Intergenic
964974628 3:162603939-162603961 AAAAGAAAAAAAAAGAATAGTGG - Intergenic
965057929 3:163745527-163745549 AAAAGAAGACAGAAAAATGAGGG - Intergenic
965203724 3:165693586-165693608 AAAAGGAGACAGGAAAATGTGGG - Intergenic
965417638 3:168416954-168416976 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
965454051 3:168875314-168875336 AAAAAGAAAGAAAAGAAGGGAGG - Intergenic
965563919 3:170090620-170090642 AAAAGGAAAGAGAATAAAGTAGG + Exonic
966246543 3:177814259-177814281 AAAAGTAAACATAAGAAAGCTGG + Intergenic
966270570 3:178099648-178099670 AATAGAAAGCAAAAGAATGGAGG + Intergenic
966374101 3:179277962-179277984 CAAAGGAATCAGAAGAAAAGGGG - Intergenic
966402313 3:179561001-179561023 AAAAGAAAACAAAAGAAAGAAGG - Intergenic
966479461 3:180389782-180389804 AAAAGAAAAGAGGAGAATGAGGG + Intergenic
966528492 3:180946269-180946291 AAAATGGAACAGAGGAATGATGG - Intronic
966659697 3:182400588-182400610 AAAAGGAAAGAGAAAAGAGGGGG + Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966929702 3:184668236-184668258 TCATGGAAACAGCAGAATGGTGG + Intronic
967155169 3:186685227-186685249 AGAAGAAAACAGAAAAATGTGGG - Intergenic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
967422034 3:189284161-189284183 AAAAGGGAAAAGAAAAATGCGGG - Intronic
967549116 3:190768588-190768610 AGAAAGAGAAAGAAGAATGGGGG - Intergenic
967740339 3:192996926-192996948 TAAGGGAGACAGAGGAATGGAGG - Intergenic
968227083 3:196979518-196979540 AAAAGAAAAAAAAAGAATTGAGG + Intergenic
968400665 4:293492-293514 AAAAGCAGAAAGTAGAATGGTGG + Intronic
968712635 4:2130248-2130270 AAAAGAAAACAGAAGAGGAGAGG + Intronic
968715355 4:2154268-2154290 AAAAGGCAAAAGAAAATTGGAGG + Intronic
968803999 4:2760951-2760973 AAAAGGACACAGAAGAAAATCGG - Intergenic
968859887 4:3159162-3159184 AAAAGGAATCAGAGGAGTGCAGG - Intronic
969041250 4:4297778-4297800 AAAAAAAAAAAAAAGAATGGTGG + Intronic
969193033 4:5538073-5538095 AAAAGGAAAGAAAAGAAGGAAGG + Intergenic
969828171 4:9774762-9774784 AGAAGGAAAAAGAAGAACGGAGG - Intronic
969921859 4:10547672-10547694 AGAAGCAAAGAGTAGAATGGTGG - Intronic
969931751 4:10637572-10637594 AAAAAAAAAAAGAGGAATGGTGG - Intronic
970632364 4:17963376-17963398 GAAAGGAATCAGAACAAAGGGGG + Intronic
970760826 4:19484010-19484032 AAAAGAAAAAAAAAGAATGCTGG + Intergenic
970767198 4:19563952-19563974 ATAAGGAAACAGAAGGGCGGGGG - Intergenic
970923386 4:21421581-21421603 ACAAGAAAACTGTAGAATGGTGG + Intronic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971663539 4:29452294-29452316 ACAAGGAAAGAGTAGAATGATGG + Intergenic
971681856 4:29710087-29710109 AAAAGGAAAGAAAGGAAGGGAGG + Intergenic
971777177 4:30981214-30981236 ACAAGGAAACAGAGGAATGGGGG - Intronic
971862447 4:32125444-32125466 AAATTGTAACAGAAGGATGGGGG + Intergenic
972028656 4:34422337-34422359 AAAAGGACACAAAAAAAGGGTGG + Intergenic
972191580 4:36598540-36598562 GAAAGGAAACAGAAGAAGGTAGG + Intergenic
972342568 4:38165158-38165180 AAAAAGAAACTGTAGACTGGGGG - Intergenic
972430114 4:38973191-38973213 AAATTGAAATAGAAGAATAGAGG - Intronic
972713861 4:41626022-41626044 AAAAAGAAAAAGAAGAGAGGTGG + Intronic
972844998 4:42976997-42977019 AAAAGTAGAGAGTAGAATGGTGG - Intronic
972943164 4:44221746-44221768 AAAAGCAGACAGAAGAACGGTGG - Intronic
973104016 4:46309248-46309270 AAAAGAAAACGGAAGAATGGTGG - Intronic
973215991 4:47669982-47670004 AAAGAAAAACAAAAGAATGGAGG - Intronic
973237090 4:47916964-47916986 AAAAGGACCTAGAAGAATGCTGG - Intronic
973633102 4:52838012-52838034 AAAAGGGAACAGAAGCATCTTGG - Intergenic
973689741 4:53414543-53414565 AAAAAAAAACAGAACAAGGGGGG + Intronic
973784470 4:54322182-54322204 AAAAATAATCAGAAAAATGGTGG - Intergenic
974002076 4:56521965-56521987 AAAAGAAAAGAGAGGAGTGGAGG - Intronic
974145550 4:57943184-57943206 AAAAGGAGACAGTTGAATAGCGG + Intergenic
974234140 4:59159479-59159501 AAATGGAAAGAGATCAATGGGGG + Intergenic
974256373 4:59460158-59460180 AAAAGAAAACCTAAAAATGGAGG - Intergenic
974332869 4:60502962-60502984 AAAAGGAAAGAAAAGAAAGGAGG - Intergenic
974466868 4:62269085-62269107 AAAACCAAAAAGAAGAATGAGGG + Intergenic
974624426 4:64403760-64403782 AATAGGAAAAAGAAGACTGAGGG + Intronic
974835687 4:67247493-67247515 GAAAGGACACAGAAAAATGATGG + Intergenic
975162094 4:71135754-71135776 AAAAGCAAAAAGTAGAATGGTGG - Intergenic
975229654 4:71917033-71917055 AAAGGGAAAAAGAAAAATGAAGG - Intergenic
975294567 4:72718111-72718133 AAAAGTAGAGAGCAGAATGGTGG + Intergenic
975698268 4:77036256-77036278 AAAAGCAAAAACAAGAATGTTGG - Exonic
975699722 4:77051913-77051935 AAAAAGAACCAGGAGACTGGTGG + Intronic
975883861 4:78941385-78941407 AACAGGAAAAGGAAGAAAGGAGG + Intergenic
976056523 4:81075311-81075333 TCAAAGAAACAGTAGAATGGTGG + Intergenic
976501352 4:85793864-85793886 AAAAGGAAACAGCAAAATTCTGG + Intronic
976526052 4:86090215-86090237 AAAAATAAACAGAAGAATTAGGG + Intronic
976675208 4:87695354-87695376 AGAAAGAAAAAGAAGAAAGGAGG + Intergenic
976886364 4:89989647-89989669 TAAAGTCAACAGAAGAATGTTGG + Intergenic
976961047 4:90974020-90974042 AAAAGCAGAAAGTAGAATGGTGG + Intronic
977003535 4:91534895-91534917 AAATGGGAATAGAAGAATGTTGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977080221 4:92517548-92517570 AAAAGGAAACAGAAGATATGAGG - Intronic
977330828 4:95635236-95635258 AAAAGGATGCAGAAGCATTGTGG + Intergenic
977386784 4:96350172-96350194 AAAAAAAAAAAAAAGAATGGTGG + Intergenic
977450871 4:97195559-97195581 AAAATGGAACAGAATAATAGAGG - Intronic
977507584 4:97921981-97922003 AAAAGCAGAGAGTAGAATGGTGG + Intronic
977697683 4:99984762-99984784 AAAAGCAGAGAGCAGAATGGTGG - Intergenic
977927948 4:102722058-102722080 AAAAGAAAAGAGTAGAATGCTGG + Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978179982 4:105782195-105782217 AAAAGGAAAAAGGAGAAAGACGG + Intronic
978181726 4:105805802-105805824 AAGAAGAGGCAGAAGAATGGAGG - Intronic
978201487 4:106028258-106028280 AAAAAAAAACAGAAAAATGTGGG + Intergenic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978461695 4:108962177-108962199 AAAAGAAAAAAAAAGAATCGAGG - Intronic
978508395 4:109486521-109486543 AAAAGGAAAGAGAAAAAGAGAGG - Intronic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
978581846 4:110239729-110239751 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
978663256 4:111153253-111153275 AAAAGGAACCTAGAGAATGGAGG - Intergenic
978751381 4:112251718-112251740 TAAAGGAGAGAGAAGAGTGGAGG + Intronic
978856867 4:113403563-113403585 AAATGGAAACTGATGAATAGAGG + Intergenic
979003211 4:115253937-115253959 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979028555 4:115608846-115608868 AAAAGGACAGAGAAGTAGGGTGG - Intergenic
979137404 4:117127271-117127293 AGAAGAAAACAGAAAAATGTGGG + Intergenic
979148542 4:117277988-117278010 GAAAGGCAACAGAAGAATGGAGG + Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
979648296 4:123098547-123098569 AAAAGCAGAAAGTAGAATGGTGG - Intronic
979741007 4:124151004-124151026 AAATGGAGAAAGGAGAATGGAGG + Intergenic
979768238 4:124489540-124489562 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979776577 4:124596063-124596085 AAAAAGAAATAGGAGAATTGGGG + Intergenic
979830750 4:125298361-125298383 CAAAGGAAAAACATGAATGGAGG + Intergenic
980212554 4:129808565-129808587 GAAAGGAAAAAGTTGAATGGAGG + Intergenic
980500805 4:133650308-133650330 AAAAGGAAAAAAAAGAAAGAGGG - Intergenic
980631764 4:135445984-135446006 AAAAGCAGAAAGTAGAATGGTGG + Intergenic
980751397 4:137094684-137094706 AAAAGAATAAAGCAGAATGGTGG + Intergenic
980758225 4:137192838-137192860 AAAAGGAAAGAGGAGAAAAGAGG + Intergenic
981096011 4:140782537-140782559 AAAAAGTAAAAGAAGAAAGGGGG + Intergenic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981242146 4:142490740-142490762 AAAAGCAGAGAGTAGAATGGTGG - Intronic
981601251 4:146491526-146491548 AAAAGGAAAAAGATGGAGGGAGG + Intronic
981825685 4:148938701-148938723 AAAAAAAAATAGGAGAATGGGGG - Intergenic
982126064 4:152184906-152184928 AAAAAGAAAAAGAAAAAAGGTGG + Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
982341841 4:154308272-154308294 ACAAAGAAACAAAAGAAGGGAGG + Intronic
982380800 4:154744988-154745010 AAAAGGAAAAAGAAAAAGGATGG - Intronic
982589447 4:157287609-157287631 AAATTGAAACTGAAAAATGGTGG + Intronic
982603348 4:157481432-157481454 AGAAGTAAACAGTAGAATAGTGG + Intergenic
982656858 4:158160916-158160938 AAAAGTAGAGAGTAGAATGGTGG + Intronic
982759819 4:159268043-159268065 AAAAGGAAAAAAAAAAAGGGAGG - Exonic
982782139 4:159502176-159502198 AAAAGGAAAGAGAACAATCCAGG - Intergenic
982797545 4:159663923-159663945 AAAAGGAAAAAAAAGAAAAGGGG - Intergenic
982822568 4:159961332-159961354 AGAAGTAAAGAGAAGAATAGTGG - Intergenic
982981553 4:162142633-162142655 ATAAGGAAGAAAAAGAATGGGGG + Intronic
983058264 4:163125110-163125132 AAAAGGAAACAGCAGATGTGTGG - Intronic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983090216 4:163494155-163494177 GAAAGGAAAGAGAAGAGGGGCGG + Intergenic
983271338 4:165565732-165565754 TAAAAGAAACAGAAAAATGGAGG + Intergenic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
983867243 4:172782603-172782625 AAAAGGAAAAAGGAAATTGGTGG - Intronic
983897492 4:173097641-173097663 AAAAAGAAAAAAAAGAAAGGTGG + Intergenic
984167914 4:176325021-176325043 AAAAGGAAACAGCTGAGTGGTGG - Intronic
984236971 4:177171324-177171346 AAAAGGAAAAAAAAAAGTGGGGG + Intergenic
984443847 4:179808262-179808284 AAAATGAAACTGAAAATTGGTGG + Intergenic
984686881 4:182679214-182679236 AAAAAGAAAGAGTAGAATGATGG + Intronic
984687879 4:182691660-182691682 AAAGGGAAACCCAAGAAAGGAGG - Intronic
984980264 4:185273698-185273720 AAAAGCAGAGAGTAGAATGGTGG - Intronic
985271552 4:188198341-188198363 AAAAAGAAAAAGAAAAATTGAGG + Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986365420 5:7023735-7023757 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
986491451 5:8295575-8295597 AAATGGGATCAGAAAAATGGGGG + Intergenic
986539039 5:8825087-8825109 AAAAGGAAAAAAAAAAATTGGGG + Intergenic
986606390 5:9527367-9527389 AAAAAGAAAGAGAAGTATGCTGG - Intronic
986667537 5:10116570-10116592 AAAAAGAGAGAGAAGAAGGGAGG + Intergenic
986691489 5:10317195-10317217 AGAAGGAAAGAGAAGAAAGAAGG - Intergenic
986897500 5:12387638-12387660 AAAAGGCTACAAAAGCATGGTGG + Intergenic
987070556 5:14333473-14333495 AAATGTAATCAGAAGAATGATGG - Intronic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987151471 5:15045107-15045129 GAATGGGAACAGAAGTATGGTGG + Intergenic
987452355 5:18101731-18101753 AGAAGTAGACAGAAGAATGCTGG - Intergenic
987570066 5:19645698-19645720 GAAAGGAAACACAAGAAAGATGG + Intronic
987749178 5:22017755-22017777 AAAAAAAAAAAAAAGAATGGAGG - Intronic
987807392 5:22786689-22786711 AAAAGAAAAAAAAAGAATGTAGG - Intronic
988068463 5:26254186-26254208 CAAAGGAAACAGAACAAAGCTGG - Intergenic
988235948 5:28544847-28544869 AAAAAAAAACATAAAAATGGGGG - Intergenic
988310410 5:29549368-29549390 AGAAGGAGACAGAAAAATGTGGG - Intergenic
988389931 5:30615250-30615272 CAAAAGAAACAAAACAATGGTGG - Intergenic
988714906 5:33815847-33815869 GAAAGGAAAGAGAAGAAAGAGGG - Intronic
989104850 5:37852412-37852434 AGAAGGAAGCAGAAGAAGGGAGG + Intergenic
989400390 5:41001735-41001757 AAAAGAAAACAAGAGAAAGGTGG + Intronic
989686245 5:44090463-44090485 ACAAGGAAGAAGAAGAATAGTGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989972352 5:50540327-50540349 AAAAGGAAAGAGAGGAAGGAAGG + Intergenic
990031180 5:51261464-51261486 AAAAGCAGGCAGAAGAATGTGGG + Intergenic
990370852 5:55116763-55116785 AAAGGGAAAAGGAATAATGGTGG + Intronic
990541174 5:56773749-56773771 AAAAGAAAACAAAAGAATGTTGG - Intergenic
990931766 5:61099806-61099828 AATAGGCAACAGAAGAGAGGAGG - Intronic
991028500 5:62057295-62057317 AAATGGAAACAGAAAAAAGCAGG - Intergenic
991114091 5:62934091-62934113 AAAAGGAAAAAGGAAAATTGAGG - Intergenic
991161064 5:63503723-63503745 AAATGGAAACAGAAAAATGCAGG - Intergenic
991330043 5:65484530-65484552 AAAAAGAGACAAGAGAATGGCGG - Intergenic
991423243 5:66463225-66463247 AAATTGAAGCAGAAGAGTGGAGG + Intergenic
991440262 5:66640094-66640116 AAAAGGAAGCAGAATAGAGGTGG - Intronic
991596822 5:68315054-68315076 ATTAGGAAACAGGAGAAAGGTGG + Intergenic
991620603 5:68541124-68541146 AAAAGGAAATAGAAAAAATGCGG - Intergenic
991979529 5:72216758-72216780 AAAAGGAAAAAAAAGCAAGGCGG - Intergenic
992058715 5:73020286-73020308 AAAAGGATGAAGAAGCATGGTGG + Intronic
992180422 5:74191695-74191717 AAAAGGAAATAGAAGTATACAGG - Intergenic
992232230 5:74674617-74674639 AAAAAGAAGAAGAAGAAAGGAGG + Intronic
992389576 5:76317957-76317979 AAAAGGACACTGAAAAATGGTGG - Intronic
992420715 5:76601835-76601857 AAAAGGTAATGGAAGGATGGTGG + Intronic
992543016 5:77783039-77783061 GACAGGAAACAGGAGAATAGGGG + Intronic
992590028 5:78285270-78285292 AGAAGGAAGAAGAAGAATTGTGG - Intronic
992746511 5:79825979-79826001 AGAAAGAAAGAGAAGAAAGGAGG + Intergenic
992885383 5:81153675-81153697 GAAAGCAAATAGAAAAATGGCGG + Intronic
993069684 5:83144662-83144684 AAAAGGAAAAAAGAGAATGGAGG - Intronic
993189284 5:84660652-84660674 CAAAGCCAACAGAAGAATTGAGG - Intergenic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
993539630 5:89132882-89132904 AAAAGTAAATTGGAGAATGGAGG - Intergenic
993670010 5:90748733-90748755 AAAAAGATACAGAATGATGGTGG - Intronic
993856354 5:93080837-93080859 AAAAGAAAACAGAAACATAGGGG - Intergenic
993923622 5:93838438-93838460 ATAAGCAAACAGAACAAAGGTGG - Intronic
993994163 5:94700674-94700696 AGAAGTAGACAGTAGAATGGTGG - Intronic
994141668 5:96348231-96348253 GAAAGGTAACAGAAGAAGGAAGG + Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994362523 5:98869167-98869189 AGAAGGAACCAGAAGAAAAGAGG - Intronic
994588850 5:101748359-101748381 AAAAGCAAGCAGAAGAAAGTGGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
994885795 5:105559790-105559812 AAAATGAATCAGAAGAAATGTGG - Intergenic
994960307 5:106593528-106593550 AAAAGGAAAAAGAACAAAGCTGG + Intergenic
994999966 5:107115309-107115331 AAGAGGAAAAATAAGAATAGTGG - Intergenic
995016814 5:107319064-107319086 AGAAGGAAAGAGAAGAAAAGAGG - Intergenic
995076502 5:107991073-107991095 AAAAGGAAACAGAAAACTGTAGG + Intronic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995419329 5:111945550-111945572 AAGAAGAAACAGAAGAAAAGAGG + Intronic
995562262 5:113395616-113395638 AAAGGGAAACAGCAGCCTGGGGG - Intronic
995702729 5:114954488-114954510 AAAAGAAGACAGAATAATGTGGG + Intergenic
995702735 5:114954545-114954567 AGAAGAAAACAGAAAAATGTGGG + Intergenic
995703423 5:114960714-114960736 AAAAAGAAACATAGGAATAGTGG - Intergenic
996111485 5:119571317-119571339 AAAAGGGAAAGGAAGAAAGGGGG - Intronic
996167109 5:120237816-120237838 AAAAGGAAGCAGAAGAGGAGTGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996423039 5:123283264-123283286 AAAAGAAACAAGAAGAATAGCGG - Intergenic
996501505 5:124222173-124222195 AAAAAAAAAGAGAAGAATAGAGG - Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996522147 5:124438971-124438993 TGAAGGAAACAGAACAATGGGGG + Intergenic
996548346 5:124704940-124704962 ACTGGGAAACAGAAGAAGGGTGG + Intronic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996885620 5:128350558-128350580 AAAAGTAAACAAAAGATTTGAGG + Intronic
996985734 5:129561541-129561563 AAAAAAAAAAAGAAAAATGGAGG + Intronic
997063726 5:130538428-130538450 AAAAGAAAAGAATAGAATGGTGG + Intergenic
997086096 5:130801446-130801468 AAAAGCAGAGAGTAGAATGGTGG + Intergenic
997130810 5:131274125-131274147 AAATGGATACAGAAGTCTGGAGG - Intronic
997511985 5:134460390-134460412 GAAAGGAAAGAAAAGAAGGGGGG + Intergenic
997850101 5:137324579-137324601 AAAAACAAAAAGTAGAATGGTGG + Intronic
998154880 5:139779702-139779724 GAAAGAAATCAGAACAATGGGGG - Intergenic
998243168 5:140469131-140469153 AAAAGGAAGAAGAAGGAAGGAGG - Intronic
998425727 5:142027027-142027049 GAAAGGAAAAAGAAGAAAGAAGG - Intergenic
998525333 5:142837692-142837714 AAAAGGAACAAGAAGAATCAGGG - Intronic
998708679 5:144795514-144795536 TAAAGAAAACAAAAGAATGAAGG - Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999181643 5:149674060-149674082 AAAAAAAAAAAGTAGAATGGCGG + Intergenic
999513202 5:152274260-152274282 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
999558354 5:152770671-152770693 AAAAGGAAAGGGAAGGATGGAGG + Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
999665213 5:153905678-153905700 AAAGAAAAACAGAAGAATGATGG + Intergenic
999695794 5:154188057-154188079 AAAAGGATAAAGTAGAATGGTGG + Intronic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
999881723 5:155871900-155871922 AAAAAGATAGAGAAGCATGGAGG + Intronic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
999947865 5:156617005-156617027 AGAAGAATACAGCAGAATGGAGG - Intronic
1000469831 5:161627569-161627591 AAAAAGAGAGAGAAGGATGGAGG - Intronic
1000697472 5:164405564-164405586 AAAAGGACACAGAAGTTTGGAGG + Intergenic
1000888139 5:166771434-166771456 AAAAATAAATAGAAGATTGGGGG - Intergenic
1001632735 5:173188046-173188068 AAAAGGAAAAAAAAGAAAGTTGG + Intergenic
1002408707 5:179056230-179056252 AAAAGGGAACAGGAACATGGAGG - Intergenic
1002606236 5:180384691-180384713 AAAAGAAAAGAAAAGAGTGGAGG + Intergenic
1002610281 5:180413298-180413320 AAAGGGAAACAAAAGAAGAGAGG - Intergenic
1002629235 5:180558603-180558625 AAAAGCAAACACAAGAAGGAAGG - Intronic
1002794372 6:459605-459627 AAAAGCAAATAGAAGAAAGGAGG + Intergenic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003166363 6:3682411-3682433 GAGAGGAACCAGAAGACTGGAGG - Intergenic
1003254509 6:4462819-4462841 AAAAGGAAAAAGAGGAAAAGGGG + Intergenic
1003309876 6:4961312-4961334 AAAAGGAAGAACAAGAAGGGAGG + Intergenic
1003360640 6:5421860-5421882 AGAAGAAAACAGAAAAATGTGGG - Intronic
1003444629 6:6173396-6173418 AAAAAAAAAGAAAAGAATGGAGG - Intronic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004022028 6:11784773-11784795 AAAAGCAGAGAGTAGAATGGAGG + Intronic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004548507 6:16623679-16623701 AAATGGGAACAGAAGATTGGGGG - Intronic
1004879729 6:19995872-19995894 AAAAAGAAAAAGAAAAAGGGTGG - Intergenic
1005200097 6:23335014-23335036 AAAAGGGAAGAGAAGAAGAGGGG - Intergenic
1005286487 6:24333084-24333106 AAAGGCAAAAAGAAGAATGAGGG + Intronic
1005328772 6:24728696-24728718 AAAAGGAAACATAATAATTGAGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005471953 6:26169913-26169935 AAAAAGAAAAAGAAAAAGGGGGG + Intronic
1005544377 6:26849924-26849946 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1005579165 6:27217226-27217248 AAAAGAAAAAAGAAAAATGTCGG - Intergenic
1005956892 6:30670469-30670491 AGAAGAAAAAACAAGAATGGAGG + Intronic
1006007364 6:31013121-31013143 AAAAAAAAAAAAAAGAATGGGGG - Intronic
1006019273 6:31108117-31108139 AAAAGAAAAGAAAAGAAAGGCGG - Intergenic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006557921 6:34885073-34885095 AAAATAAATCAGAAGAATGTAGG - Intronic
1006560549 6:34908026-34908048 AAAAGGAAAAAAAAGAACAGTGG + Intronic
1006791658 6:36705117-36705139 AAAAAAAAAAAGAAGAATGAGGG + Intronic
1007128069 6:39444231-39444253 AAAAGAAAAAAAAAGAAAGGTGG - Intronic
1007377588 6:41467345-41467367 AAAGGGAGAGAGAAAAATGGTGG + Intergenic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1007552812 6:42743276-42743298 AAAAAGAAAAAAAAGAAAGGGGG - Intergenic
1008209684 6:48705155-48705177 GAAAAGAAACAGCAGAAGGGAGG + Intergenic
1008252559 6:49258303-49258325 TAAAGGCAACAGCAGATTGGGGG + Intergenic
1008512395 6:52288665-52288687 AAAAAAAAAAAAAAGAATGGGGG - Intergenic
1008516483 6:52324057-52324079 AAAAGAAGACAGAAAAAAGGGGG + Intergenic
1008802342 6:55384462-55384484 AAATGTAAACAGTAGAATTGTGG - Intronic
1008843131 6:55928625-55928647 ACAAGGAAAAAGAACACTGGGGG - Intergenic
1008863207 6:56176834-56176856 AAAATGAAGAAGAAGAATGAAGG + Intronic
1008936412 6:56997339-56997361 AAAAGGAAACAAAACAGGGGAGG - Intronic
1008954984 6:57205693-57205715 AAAAGAAAAGAAAAAAATGGGGG + Intronic
1009396353 6:63204539-63204561 AAAAGAAGACAGAAAAATGTTGG - Intergenic
1009601160 6:65801917-65801939 AAAGTGAAAAAGAAGAATGGTGG - Intergenic
1009621946 6:66088753-66088775 AAAAAGAAAGAGAAGAATGAAGG + Intergenic
1009632791 6:66220599-66220621 AGAAAGAAAGAGAAGAAAGGAGG - Intergenic
1009890698 6:69677507-69677529 AAAGGGGAACAGAAGAAAGAAGG + Intronic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010092320 6:71998298-71998320 AACAGGAAACTGAAGAGTGGAGG - Intronic
1010321362 6:74514094-74514116 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1010321417 6:74514774-74514796 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1010415665 6:75608488-75608510 AAGAGGAAAAAGAGGAAAGGAGG + Intronic
1010596538 6:77769964-77769986 AAAAGGAGACAGAAGAGTAAAGG + Intronic
1010927002 6:81755039-81755061 AAAAGGAAATGGAGGAAGGGAGG + Intergenic
1011012927 6:82722262-82722284 AAAAAGACACAGAATAAAGGGGG + Intergenic
1011103047 6:83745485-83745507 AAAAGGAAACAGATGACTGTAGG + Intergenic
1011178401 6:84589894-84589916 AAAAGGAAATAAAAGAAAGAAGG + Intergenic
1011349583 6:86407811-86407833 AAAAGAAAAGAAAAGAAAGGAGG - Intergenic
1011722028 6:90167346-90167368 AAAAAGAAAAAGAAAAAAGGAGG - Intronic
1011884115 6:92071912-92071934 AAAAGCAGAGAGTAGAATGGAGG + Intergenic
1011895721 6:92222483-92222505 AAAAGGTGACAGCAGAATAGAGG + Intergenic
1012041126 6:94205425-94205447 CAAAGGAAAGAGTAGAATTGGGG + Intergenic
1012185866 6:96216222-96216244 AAAAGGAAAAAGAAGAATTAAGG - Intergenic
1012614156 6:101254965-101254987 AAAAGAAAACAGAACAGAGGGGG + Intergenic
1012660673 6:101886801-101886823 AAAGGTAGAAAGAAGAATGGTGG - Intronic
1012668482 6:102010368-102010390 AAAAAGAAAAAGAAGAAGTGGGG - Intronic
1012676372 6:102118188-102118210 AAAAAGAAAAAGAAAAAGGGAGG + Intergenic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1012809638 6:103940795-103940817 TAAAGGAAAGAGAAAAATGGGGG + Intergenic
1012985102 6:105867300-105867322 AAAAGGAATAAGAACAAAGGAGG + Intergenic
1013641826 6:112091041-112091063 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1013719464 6:113006314-113006336 ACAAGGAAACCAAAGAATGGTGG - Intergenic
1013796408 6:113894120-113894142 ACAAGGAAACAGAATAATGAGGG - Intergenic
1013815287 6:114090633-114090655 AAAAGGAAATGGGAGAAGGGAGG - Intronic
1013831123 6:114273891-114273913 AAAAGGCAAAAGAAAAATTGGGG + Intronic
1014368732 6:120578672-120578694 AAAAGTAAACAATAGAATAGAGG + Intergenic
1014442674 6:121491559-121491581 AATAGGGAAAAGCAGAATGGTGG + Intergenic
1014869056 6:126568851-126568873 ATAAGTAGACAGTAGAATGGAGG + Intergenic
1014926293 6:127274938-127274960 AAAACAAAACAAAAGAATTGTGG + Intronic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015066122 6:129031079-129031101 AAGAGGAAACAGAATATTTGTGG + Intronic
1015115506 6:129644571-129644593 TAAAGGAGACAGAAGTAAGGTGG - Intronic
1015120918 6:129700770-129700792 AGAAGGAAACAAAAAAATTGAGG + Intronic
1015148335 6:130012563-130012585 AAAAGGAGAGTGTAGAATGGTGG + Intergenic
1015290520 6:131533206-131533228 AGAAGGAAACAGAGGAAAGCAGG + Intergenic
1015317195 6:131829900-131829922 AACAGGAAAGAGAACATTGGAGG - Intronic
1016387647 6:143544042-143544064 AAAGGGGAACAGAAGATAGGAGG - Intronic
1016455433 6:144225608-144225630 AAAAGGAAAGAGAAGAAAAAAGG + Intergenic
1016657306 6:146535968-146535990 TAAAGTAAACAGATCAATGGCGG + Intergenic
1016780155 6:147948979-147949001 AACAGGAGACAGAAAGATGGAGG + Intergenic
1017102163 6:150858350-150858372 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1017433869 6:154397523-154397545 AAAAGAAAAAACAAGCATGGTGG - Exonic
1017679100 6:156845890-156845912 AAAAGCAATCAGATGAAAGGAGG - Intronic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1018008610 6:159647574-159647596 AAAAGGAAAGAAAGGAATGGAGG + Intergenic
1018021492 6:159765421-159765443 AAAAAGAAAAAGAAGAAATGAGG - Intronic
1018324562 6:162651204-162651226 AAAATGTACCAGGAGAATGGAGG - Intronic
1018501237 6:164413027-164413049 AAATGGAATCAAAATAATGGAGG - Intergenic
1018631258 6:165825165-165825187 AAAAGAAAAAAAAAGAAAGGGGG + Intronic
1018637038 6:165871783-165871805 AAAAGGAGACAGCAGCCTGGAGG + Intronic
1019034358 6:169041934-169041956 AAAAGGAAACACAGGAGAGGGGG - Intergenic
1019616854 7:1967335-1967357 AAAAGGAAAAACAAAAATGGAGG + Intronic
1020353467 7:7251047-7251069 AAAAAAAAAAAAAAGAATGGGGG - Intergenic
1020353802 7:7254831-7254853 AAAATGAAACAGAAGAAAGTAGG - Intergenic
1020372643 7:7450712-7450734 AAAAGGAAACAGAATGTTTGTGG + Intronic
1020498585 7:8888295-8888317 AATAGTAAACAGAAGAGTGAAGG + Intergenic
1020545679 7:9527086-9527108 AAAACGGAACAGAGAAATGGAGG + Intergenic
1020559472 7:9712929-9712951 TTAAGGAAACAGAAGAACGAGGG + Intergenic
1020635489 7:10691546-10691568 AAAAGGAAAGAAAAGAAAGGGGG + Intergenic
1020667853 7:11069697-11069719 AAAAGGAAAGACAAGAAAGAAGG - Intronic
1020837617 7:13173668-13173690 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1020863207 7:13521228-13521250 AGAAGGAATCTGAAGAGTGGTGG - Intergenic
1021128622 7:16883385-16883407 AAAAAGAAACAAAAAAAGGGTGG - Intergenic
1021158101 7:17236986-17237008 AAAAGGAAACAACAGAACCGTGG - Intergenic
1021159541 7:17255140-17255162 TGAAGGAAAAAGCAGAATGGAGG + Intergenic
1021511622 7:21439496-21439518 AAAAGGAAAGAAAAGAAAGGAGG - Intronic
1021543262 7:21784097-21784119 AAAAGAAAACTGAAGAACAGAGG + Intronic
1021881982 7:25104006-25104028 AGAAGGAAAGAGTAGAATGGTGG - Intergenic
1022000838 7:26224636-26224658 AAAAGCAGAGAGTAGAATGGGGG + Intergenic
1022030129 7:26485156-26485178 AAAAGGATAAAGAAGAGCGGGGG - Intergenic
1022177135 7:27882149-27882171 AAAATAAAACTGAAGAATTGGGG + Intronic
1022181686 7:27926701-27926723 ACAAGGACACTGAGGAATGGAGG + Intronic
1022234196 7:28445535-28445557 AAAAAGAAAAAGAAGAATATTGG - Intronic
1022436081 7:30387038-30387060 AACAGGATGCAGAACAATGGGGG - Intronic
1022473327 7:30694846-30694868 AAAAGGGAAGGGAAGAAAGGAGG + Intronic
1022483611 7:30760379-30760401 ATAAAGACACAGTAGAATGGCGG - Intronic
1022766627 7:33419897-33419919 AAAAGAAAACAAAAAATTGGTGG + Intronic
1022856915 7:34323860-34323882 AAAATGAAAAAGAAGAAAGTGGG + Intergenic
1022918253 7:34983492-34983514 AAAGGGAAAGAGAGGAAGGGAGG + Intronic
1023006400 7:35873783-35873805 AAAAGGAATCAGAAGTATCAAGG - Intronic
1023283036 7:38591260-38591282 AAAAGAAAAGAAAAGAAAGGAGG - Intronic
1023427480 7:40053746-40053768 AAAAAAAAAAAGAAAAATGGTGG - Intronic
1023434580 7:40128924-40128946 AAAAAAAAAAAAAAGAATGGTGG + Exonic
1023679266 7:42667513-42667535 AACAGGAGACAGAAGAAGAGGGG - Intergenic
1023713785 7:43022305-43022327 ACAGGCAAACAGAAGGATGGGGG + Intergenic
1023996197 7:45160470-45160492 ATAAGGAAACAGAAATCTGGAGG + Intronic
1024029920 7:45451359-45451381 AAAAAGAAAAAGAAAAAAGGTGG - Intergenic
1024172976 7:46809509-46809531 ACAGGGAGACAGAAGAGTGGAGG - Intergenic
1024502464 7:50125785-50125807 AGAAGCAAAGAGTAGAATGGTGG + Intronic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1024771071 7:52723935-52723957 AAAAGGAAAAAGAAGGCCGGGGG - Intergenic
1024859974 7:53827400-53827422 CAAAGGAAAAAGAAGAAAGCTGG + Intergenic
1025308166 7:57886990-57887012 AAAACTAAACAGAAGAATTCTGG - Intergenic
1025520431 7:61722757-61722779 AAAAGTAGACAGAAGAATTATGG - Intergenic
1025544751 7:62151412-62151434 AAAAGTAGACAGAAGAATTATGG - Intergenic
1025913425 7:65846447-65846469 AAGAAGAAACATAGGAATGGAGG - Intergenic
1025992872 7:66508771-66508793 AAAAAGAAAGAAAAGAAAGGAGG - Intergenic
1026041099 7:66868892-66868914 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1026263190 7:68773463-68773485 ACAAGGACACAGAGGAAAGGTGG + Intergenic
1026266928 7:68803382-68803404 AAAAAGAAAAAGAGGAAAGGTGG + Intergenic
1026485799 7:70819487-70819509 AGAAGGAGAGAGTAGAATGGTGG + Intergenic
1026598841 7:71756433-71756455 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1026652488 7:72227555-72227577 AAAAGAAAAAAGAAAAAAGGTGG + Intronic
1026911920 7:74095951-74095973 AAAAAGAAAAAGAAAAATAGAGG - Intronic
1026946596 7:74320223-74320245 AAAAGGAAAAAGAGCAGTGGGGG + Intronic
1026988704 7:74570958-74570980 AAAAGGGAACTGGAGAAGGGTGG - Intronic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027401800 7:77816752-77816774 AGAAGTAAAAAGTAGAATGGAGG - Intronic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1027790078 7:82628396-82628418 AAAGCGGGACAGAAGAATGGTGG + Intergenic
1028117014 7:87009661-87009683 AAAAGGAAGCAGAAGAAGACTGG + Intronic
1028556447 7:92131097-92131119 AAGAGGAAAGTGAAGAATGAAGG + Intronic
1028607812 7:92674076-92674098 AAAAAAAAAAAGAAGAAAGGGGG - Intronic
1029119872 7:98260488-98260510 AAAAGAAAAAAGAAAAATGTAGG - Intronic
1029122458 7:98278087-98278109 AAAAGGAAACTGAAGCACAGAGG - Intronic
1029223732 7:99009867-99009889 AAAAAAAAAGAGAAGAATGAAGG - Intronic
1029531344 7:101127334-101127356 AAAAGAAAATAGAGGAATAGCGG - Intronic
1029611403 7:101628462-101628484 AAAAGAAAACAGAAAACTGGAGG + Intronic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1029945954 7:104533280-104533302 AAAAGGTAAGATAAGAAAGGAGG - Intronic
1029987353 7:104934409-104934431 AAATGGAAAGGGAGGAATGGGGG - Intergenic
1030039746 7:105439084-105439106 GAAAGGCCACAGAAGCATGGAGG - Intergenic
1030136975 7:106262568-106262590 AAAGGGAAACAGAATTAAGGAGG - Intronic
1030210245 7:106988836-106988858 AAAAGGAAAAAAGAAAATGGAGG - Intergenic
1030215247 7:107038167-107038189 AACAGCAAACTGAAGAATGCTGG - Intergenic
1030483017 7:110127978-110128000 AACATGAAACAGAAGAATGACGG - Intergenic
1030758857 7:113325248-113325270 GCAAGGAAGCAGAAGAATGTGGG - Intergenic
1030834207 7:114263380-114263402 AAAAGGAAAAGGAAGAAAGAGGG - Intronic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1030989014 7:116277707-116277729 AACAGTAAACAGAAAAAAGGAGG - Intergenic
1031085929 7:117301794-117301816 AAAAAAAAAAAAAAGAATGGAGG - Intronic
1031315556 7:120254218-120254240 AAAATGGAACACAGGAATGGAGG + Intergenic
1031436657 7:121740083-121740105 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1031601091 7:123710771-123710793 AAGAGGAGACTGAAGAATGTGGG + Intronic
1031609214 7:123805598-123805620 AAAAAGAAATAGAATGATGGAGG + Intergenic
1031631841 7:124053108-124053130 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1031834546 7:126667649-126667671 AAAAGGAAAAAGAATGATGTAGG + Intronic
1031901298 7:127414519-127414541 GAGAGGAAACACAAGAGTGGAGG - Intronic
1032217850 7:129971156-129971178 AAAAGGAAACAGAATAAGATTGG + Intergenic
1032272033 7:130418078-130418100 AAAAGAAAAGAAAACAATGGTGG - Intronic
1032305098 7:130725703-130725725 AAAAGGAAAGAAAAGAAAAGAGG - Intergenic
1032591038 7:133192861-133192883 ACATGGAAACAGTAGAATTGTGG - Intergenic
1032650857 7:133876767-133876789 GAAAGGAAAAAGAAGAATCTAGG - Intronic
1032975870 7:137221698-137221720 ACAAGGGAACAGAAGAACGGAGG - Intergenic
1033060805 7:138105158-138105180 AAAAAGTAAAAGAAGGATGGTGG - Intronic
1033108263 7:138550707-138550729 AAAAGGATTCAGAAGACTAGGGG - Intronic
1033198836 7:139350972-139350994 AGAAAAAAACAGAAGAATGTGGG - Intronic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033330566 7:140413831-140413853 AAAAGGAAACCCAGCAATGGTGG + Intronic
1033874285 7:145795223-145795245 AAAAGGAAAGAAAAGAAAGATGG + Intergenic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034465259 7:151224263-151224285 GAAAGGAATCCCAAGAATGGGGG - Intronic
1034645795 7:152646093-152646115 AAAATGAAACAGGAAAATGGTGG - Intronic
1034787543 7:153938744-153938766 AGAAGGAAAGCAAAGAATGGTGG + Intronic
1035321371 7:158031614-158031636 AAAAAGAAAAAGATAAATGGAGG + Intronic
1035796698 8:2364206-2364228 AAAAGCAAAGATAAGAATGAAGG + Intergenic
1035968259 8:4219122-4219144 AAAAGGGCACAGATGAAAGGAGG - Intronic
1035972163 8:4261259-4261281 AAAAGGAAAGAGAAGAAAACAGG - Intronic
1036013385 8:4753483-4753505 GAAATGAAAAAGAAGAATGGAGG - Intronic
1036053611 8:5226865-5226887 AAAAGGAAAATGAAGAAGGAGGG - Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036164319 8:6418303-6418325 AAAAGGAAGCAAAAGAATCTGGG - Intronic
1036277819 8:7371273-7371295 AAAAGCAGAGAGTAGAATGGTGG + Intronic
1036343705 8:7940620-7940642 AAAAGCAGAGAGTAGAATGGTGG - Intronic
1036569621 8:9968703-9968725 GAAAGGAAACAGAACAATAGTGG + Intergenic
1036569863 8:9970938-9970960 AAAAAAAAAAAAAAGAATGGTGG - Intergenic
1036675765 8:10831244-10831266 AAAAGTAGACAGCAGAATAGTGG + Intronic
1036839048 8:12101388-12101410 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1036860837 8:12347631-12347653 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1036997656 8:13677613-13677635 AACAGGACACAGAAGAATATAGG - Intergenic
1037004151 8:13756429-13756451 AAAAAGAAAAAGAAAAAAGGAGG - Intergenic
1037277725 8:17199718-17199740 AGAAGGAAAAAGAAGAAAGAAGG - Intronic
1037323148 8:17662854-17662876 AAAAGAAAAAGGAAGAAAGGAGG + Intronic
1037423880 8:18733351-18733373 AAAAGGAAACTGATAAATGGAGG + Intronic
1037708413 8:21335160-21335182 AAAAGGAAAAAGATAAAAGGGGG - Intergenic
1037797518 8:22009049-22009071 ATCATGAAACAGAAGAATGGAGG - Intergenic
1037853701 8:22354081-22354103 AAGAGGCTACTGAAGAATGGTGG - Intronic
1038437694 8:27547734-27547756 AGAAGTAAAAAGTAGAATGGAGG - Intergenic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1038672482 8:29593391-29593413 AAAAGAATACAGAAGAAAAGAGG - Intergenic
1038686868 8:29727014-29727036 AAAAGGGATCATAAGAATGATGG + Intergenic
1038752204 8:30305923-30305945 AAAAAAAAAAAAAAGAATGGAGG - Intergenic
1038864002 8:31419031-31419053 AAAAGGAATCAGAAGAGTTTTGG - Intergenic
1038981171 8:32761108-32761130 AAAGGTAAAATGAAGAATGGAGG + Intronic
1039085201 8:33772978-33773000 ATAAGGAGACAGATGAATTGAGG - Intergenic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1039909961 8:41818656-41818678 GAAAGGAAAAAGAAGAAAGAAGG - Intronic
1040442013 8:47453209-47453231 AAGAGGATACAGACAAATGGAGG + Intronic
1040468256 8:47715112-47715134 AGAAGCAAACAGTAGATTGGTGG - Intronic
1040486332 8:47875419-47875441 AATAGGAAACAGAAAAATGGTGG - Intronic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040628314 8:49177970-49177992 AAGAGGACACACAAAAATGGAGG + Intergenic
1040694358 8:49978266-49978288 AGAAGGAGACAGAAGAAAGGGGG + Intronic
1040716249 8:50256556-50256578 ATAAGGAAATAGCAGAATTGAGG + Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040741243 8:50578996-50579018 AGAAGAAAACAGGAGAATGTAGG + Intronic
1040963018 8:53054626-53054648 AAAAGCAGAAAGTAGAATGGTGG - Intergenic
1040965825 8:53080055-53080077 AGAAGGAAACAGGAAAATGTGGG + Intergenic
1041003045 8:53470504-53470526 AAAAGGGAACATACCAATGGTGG + Intergenic
1041103490 8:54419318-54419340 AAACAGAAACTGAAGACTGGGGG - Intergenic
1041213441 8:55576071-55576093 AAGAGGAAACAAACAAATGGAGG + Intergenic
1041239656 8:55838610-55838632 AAAAACAAACAGATGAAAGGTGG + Intergenic
1041258976 8:56003723-56003745 AAAAGGAAATAAAAGAAAGGAGG + Intronic
1041408183 8:57524598-57524620 AAAAAGAAAAAGAAAAATTGAGG - Intergenic
1041500812 8:58536182-58536204 AAAAGGAAACAGCAGATAAGAGG + Intergenic
1041709483 8:60880289-60880311 AAAAAGAAAAAGAAGAAAGCAGG - Intergenic
1041713602 8:60914288-60914310 AAAAGGAGAGAGAAGCATGAAGG - Intergenic
1041724678 8:61006966-61006988 AGCATGAAACAGAAGAATGCAGG - Intergenic
1041901904 8:62991994-62992016 AGAAGGAAAGAGAAGAAAGTGGG - Intronic
1041907939 8:63054083-63054105 AAAAGGAAACATTAAATTGGAGG - Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042074221 8:64971747-64971769 AAAAGAAGAGAGTAGAATGGTGG - Intergenic
1042115688 8:65428657-65428679 AAATGGAAACAGAAAAAGGCAGG + Intergenic
1042278436 8:67029128-67029150 AAAAGGAAAAATAAGACTGAAGG - Intronic
1042628122 8:70782604-70782626 AGAAGCAAAGAGTAGAATGGTGG - Intronic
1042820723 8:72927254-72927276 AAAAAGAAAGAAAAGAGTGGGGG - Intronic
1042923170 8:73940093-73940115 AAAAGAAAAAAGAAAAATGTGGG + Intronic
1042994841 8:74685422-74685444 CAAAGGAAACAGTAGAATTTTGG + Intronic
1043012575 8:74899805-74899827 AGAAGTAAACAGAGAAATGGAGG - Intergenic
1043070804 8:75633501-75633523 AAAAGAAAACAGCAGAATCCAGG - Intergenic
1043099275 8:76019606-76019628 AAATAGAAACATAAGAATGATGG + Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043403977 8:79911966-79911988 AAAAGGAAAAAAAAGACTGGAGG + Intergenic
1043479112 8:80634705-80634727 AAAGAGGAACACAAGAATGGTGG - Exonic
1043609623 8:82045970-82045992 AAAAGAAAACAGAAAAGTGAAGG - Intergenic
1043693768 8:83191934-83191956 AAAATTAAACAGAAGAATATAGG + Intergenic
1043716697 8:83495912-83495934 AAATGGAAACAAAAAAAAGGAGG + Intergenic
1043854447 8:85248470-85248492 AAAAAGAAAAAGAATTATGGTGG + Intronic
1044009480 8:86975412-86975434 ATAAGTAGACAGTAGAATGGTGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044102325 8:88155883-88155905 AAAAGGATACTGAAGAATCAAGG - Intronic
1044172760 8:89076079-89076101 ACAAGTAGACAGTAGAATGGTGG + Intergenic
1044214698 8:89595421-89595443 AGAAGGAAACTGAAGAAAAGGGG + Intergenic
1044304211 8:90618955-90618977 AAAAGGATTAAGAAGAATTGAGG - Intergenic
1044381292 8:91536976-91536998 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1044899249 8:96926519-96926541 AAGAAGAAAAAGAAGAAAGGAGG - Intronic
1045021235 8:98045998-98046020 AGAAGGAAAAAAAAGAATGACGG + Intronic
1045316664 8:101049305-101049327 AAAAAGAAAGAGAAGGAAGGAGG - Intergenic
1045511795 8:102817351-102817373 AAAAAGAAAGAGAGGAATGAAGG + Intergenic
1045549784 8:103161218-103161240 CAAAGGAATCAGAGGAAAGGGGG - Intronic
1045713534 8:105014781-105014803 ATAAGGAAAAAGAAAAATGGAGG - Intronic
1045845319 8:106628173-106628195 AAAAGGACACAGAAAACAGGAGG - Intronic
1045901609 8:107288053-107288075 AAAAGGAAAAAGAATAATCTTGG + Intronic
1046024066 8:108700949-108700971 AAAAGGAAATAGATGCATTGAGG + Intronic
1046119981 8:109833693-109833715 AAAAAAAAAAAGAAGAATGCTGG + Intergenic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1046281266 8:112035414-112035436 AAAAGCAGAGAGGAGAATGGTGG + Intergenic
1046326226 8:112650725-112650747 TAAAGGAAAAAGAAGAGTAGAGG + Intronic
1046411763 8:113853851-113853873 AGAAGCAAAGAGTAGAATGGTGG + Intergenic
1046579347 8:116072353-116072375 AAAAGAAAAAAGAAAAAAGGGGG + Intergenic
1046695594 8:117335936-117335958 GAAAGGAAAAGGAAGAAGGGAGG - Intergenic
1046925341 8:119780939-119780961 AAAAAAAAAAAAAAGAATGGAGG + Intronic
1046933175 8:119861729-119861751 AAAAGGAAAGAGAAGAAGGGAGG + Intergenic
1047027506 8:120840034-120840056 AGAAGGAAACAGAAGAGCTGTGG - Intergenic
1047153957 8:122296264-122296286 AAGAAGAAAGGGAAGAATGGAGG + Intergenic
1047277979 8:123420087-123420109 AAAAGGAAACAGTAGACATGGGG - Intronic
1047327060 8:123849919-123849941 AATATGAATGAGAAGAATGGTGG + Intergenic
1047668942 8:127123821-127123843 AAAAGTACACAGAAAAATAGAGG + Intergenic
1047832024 8:128643906-128643928 GAAAGGAAAGAGAAGAAAGGAGG - Intergenic
1047894111 8:129345811-129345833 AAAAGAAAACAGAATTAAGGGGG + Intergenic
1048158801 8:131992013-131992035 AAAAGAAAAGACAAGTATGGGGG - Intronic
1048194916 8:132324535-132324557 AAAAAGAACCAGAAGAAAAGGGG + Intronic
1048236224 8:132693256-132693278 AAAAGACAACGGAAAAATGGAGG + Intronic
1048247484 8:132823699-132823721 ATAAGGAAACAGAAGCACAGAGG + Intronic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048682023 8:136853713-136853735 AAAAGGAAAAAAAAGAAGGGAGG + Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1049193448 8:141301963-141301985 AAAAAGAAAAAAAAGAATGAGGG + Intronic
1049461559 8:142731787-142731809 AAAAGTAAAAAGGGGAATGGTGG - Intronic
1050070881 9:1812517-1812539 ATAAGGAAAAAGATGACTGGGGG + Intergenic
1050165897 9:2764335-2764357 AAAGAGAAACAAAAGAAAGGAGG + Intronic
1050297549 9:4221035-4221057 AAAAGGAAAGGGAAAAATAGAGG + Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050484413 9:6118299-6118321 AAAAGGAAACAGAGGCACAGAGG + Intergenic
1050632008 9:7569557-7569579 AATAGGATACAGAATGATGGTGG - Intergenic
1050722970 9:8611955-8611977 AAAAGAAAACAAAAGAGGGGAGG + Intronic
1050915680 9:11128200-11128222 AAAAGGAAAGAGGAGAATGTAGG - Intergenic
1050935456 9:11389310-11389332 AGAAGCAAAAAGCAGAATGGTGG + Intergenic
1051109593 9:13620707-13620729 AGAAGGAAAAAGAAGAAATGAGG - Intergenic
1051322688 9:15925681-15925703 TAAAGAAAACAGTGGAATGGGGG + Intronic
1051344834 9:16142481-16142503 AGAAGGAGAGAGTAGAATGGTGG + Intergenic
1051555625 9:18379405-18379427 ACAAGGAAACTGAACAATAGGGG - Intergenic
1051641761 9:19230503-19230525 AAAAGGGAACAGAAACATGGCGG + Exonic
1051918719 9:22238329-22238351 AAAAGGAAACAAAAAGAGGGGGG - Intergenic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1051938663 9:22476382-22476404 AAAATGAAGCAGAAAAATGAAGG - Intergenic
1052003681 9:23320221-23320243 GAAAGGAAACAGGAGAAAGAAGG + Intergenic
1052137841 9:24937410-24937432 AAAAGGAAAGAAAAGAAAGATGG + Intergenic
1052287073 9:26798281-26798303 AAAATGAAACAAAAAACTGGGGG + Intergenic
1052701248 9:31940701-31940723 AGAAGGAGACAGAAAAATGTGGG + Intergenic
1053110915 9:35459343-35459365 AAAAGGAAAAAGAAAAAAAGAGG - Intergenic
1053180311 9:35962569-35962591 AAGAGGAAAAAGAAGAAAGAGGG - Intergenic
1053571847 9:39318088-39318110 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053615640 9:39762847-39762869 AAAAAGAAAAAGAATAAAGGAGG + Intergenic
1053622375 9:39832922-39832944 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053724681 9:40987479-40987501 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1053882201 9:42607336-42607358 AAAAAAAAAAAGAAGAATAGTGG - Intergenic
1053882764 9:42612258-42612280 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1053889905 9:42682044-42682066 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053890466 9:42686956-42686978 AAAAAAAAAAAGAAGAATAGTGG + Intergenic
1054093401 9:60876799-60876821 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054114884 9:61152719-61152741 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054125298 9:61300923-61300945 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054221226 9:62414804-62414826 AAAAAAAAAAAGAAGAATAGTGG - Intergenic
1054221791 9:62419726-62419748 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054228923 9:62489447-62489469 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054229488 9:62494369-62494391 AAAAAAAAAAAGAAGAATAGTGG + Intergenic
1054237881 9:62579544-62579566 AAAAAGAAAAAGAATAAAGGAGG - Intergenic
1054341289 9:63864520-63864542 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1054552011 9:66614054-66614076 AAAAAGAAAAAGAATAAAGGAGG - Intergenic
1054592872 9:67029815-67029837 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054943659 9:70771557-70771579 AAAAGGAAACTGAAGGTGGGTGG + Intronic
1054952581 9:70869348-70869370 AAATGGAAAAAGAAAAAGGGAGG - Intronic
1055018560 9:71645126-71645148 AAAAGGAAAATGAAGGAAGGAGG - Intergenic
1055148460 9:72964827-72964849 AAAAGCAAAGAGAAAAATGTTGG - Intronic
1055298146 9:74854513-74854535 AAAAGGAAAGAAAAAAATTGAGG + Intronic
1055369037 9:75577051-75577073 AAAAGGAGGGAGTAGAATGGTGG - Intergenic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055802663 9:80057296-80057318 AGAAGAAAAGAGTAGAATGGTGG + Intergenic
1055818052 9:80231041-80231063 AAATGGAAACTCAAGAATGACGG - Intergenic
1055979952 9:81991616-81991638 AAAAGGCCTCAGAAGAATGAAGG - Exonic
1056185297 9:84128770-84128792 AAAACAAAAAAAAAGAATGGTGG - Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056320481 9:85430420-85430442 AAAAGAAATGAGAAGAAGGGAGG + Intergenic
1056500333 9:87202642-87202664 AAAAAGAAAAAAAAGAATGTAGG + Intergenic
1056613892 9:88145202-88145224 AGAAGCAAAGAGAAGAAAGGAGG - Intergenic
1056678134 9:88694209-88694231 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
1056844339 9:90024531-90024553 AAAAAGAAAGACAAGAAAGGAGG - Intergenic
1057074013 9:92125260-92125282 AAAAGGAAAAAAAAAAATGATGG + Intergenic
1057778519 9:98030164-98030186 AAAAGGAAAAAGAAGAAAGGTGG + Intergenic
1057804362 9:98209979-98210001 AAAAAAAAAAAGAAGAGTGGTGG - Intronic
1057987380 9:99731124-99731146 AAAAAGTAACAGAAGAATTTTGG + Intergenic
1058040794 9:100299388-100299410 AAAAGGAAGAAGCAGAAAGGTGG + Intronic
1058067606 9:100566689-100566711 AAAAGAAAAAAGAAAAAAGGCGG - Intronic
1058083549 9:100724357-100724379 AAAAGCAGAAAGTAGAATGGTGG - Intergenic
1058176429 9:101740528-101740550 AAAAGGAAAAAGAAGATTTGGGG - Intergenic
1058317123 9:103581983-103582005 AAAAGAAAACAGAAAGATGTGGG - Intergenic
1058345553 9:103956847-103956869 AATAGGAAACAGAGGAAAAGGGG - Intergenic
1058755806 9:108082214-108082236 GGAAGGAAACAAAAGTATGGTGG - Intergenic
1059306267 9:113355521-113355543 AAAAGGATAAAGAAGAAGAGGGG - Intronic
1059370989 9:113835514-113835536 AAAAAGAAACAGAAGCTGGGAGG + Intergenic
1059563683 9:115360752-115360774 AGAAGAAAACAGAAGCCTGGTGG + Intronic
1059578181 9:115514540-115514562 AAAAGGAAACTGTAGAAAGCAGG + Intergenic
1059614660 9:115935877-115935899 AGAAGCAAAGAGTAGAATGGTGG - Intergenic
1059631905 9:116134148-116134170 AGAAGCAGACAGTAGAATGGTGG + Intergenic
1059742344 9:117164412-117164434 AAAAGTGAACAGAAGCCTGGAGG + Intronic
1059873549 9:118605450-118605472 AAAAGCGAAGAGTAGAATGGTGG + Intergenic
1059909320 9:119024910-119024932 AAAACAAAACAGAATAATGAGGG - Intergenic
1059934821 9:119299264-119299286 AGAAGCAAAGAGTAGAATGGCGG - Intronic
1059984645 9:119810097-119810119 AAAAGGAAAGACCAGAATGAAGG - Intergenic
1060485588 9:124044501-124044523 AAAAGGAAAAAGAAGAAAAGAGG + Intergenic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1061169428 9:128943644-128943666 AAAAGGAAGCAGCAAAATGTTGG - Intronic
1061321073 9:129829958-129829980 AGAAGAAAACAGAAGAATAAAGG + Intronic
1061497055 9:130981192-130981214 AAAAGGAAAGAGAAAAAAAGAGG + Intergenic
1061742884 9:132720257-132720279 AGAAGCAGAGAGAAGAATGGTGG + Intergenic
1062028231 9:134350347-134350369 AAAAGGAAACTGAGGCTTGGAGG - Intronic
1062175087 9:135157238-135157260 AAAAGAAAAGGAAAGAATGGAGG - Intergenic
1203404390 Un_KI270515v1:3829-3851 AAAACGACACAGAAGAATTCTGG + Intergenic
1185524953 X:770422-770444 AAAAGAAGAAAGAAGAAAGGAGG + Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1185807642 X:3074878-3074900 AGAAGTAGACAGTAGAATGGTGG - Intronic
1185825276 X:3243522-3243544 AGAAGGAGAGAGAAGAATGGAGG + Intergenic
1185918120 X:4058843-4058865 AAAAAGAGAAAGAAGAATGAAGG + Intergenic
1186001194 X:5012897-5012919 AGAAAGAAACAGTAGAATGGGGG + Intergenic
1186128513 X:6441863-6441885 AAAAAGAAAGAAAAGAAGGGAGG + Intergenic
1186149584 X:6660257-6660279 AACGGGAAAGAGAAGAATGTTGG + Intergenic
1186260133 X:7768776-7768798 AAAAGGGAAAATAAGAATAGAGG - Intergenic
1186282360 X:8006914-8006936 AAAGGAAAACAGCAAAATGGGGG - Intergenic
1187031144 X:15489881-15489903 AGAAGCAAAGAGTAGAATGGTGG + Intronic
1187209606 X:17216304-17216326 AAAAAAAAAAAGACGAATGGTGG - Intergenic
1187211415 X:17236111-17236133 AAGAAGAAAAAGAAGAAAGGAGG - Intergenic
1187303843 X:18077304-18077326 AAAAAAAAAAAAAAGAATGGGGG + Intergenic
1187457250 X:19452998-19453020 TCACAGAAACAGAAGAATGGTGG + Intronic
1187549540 X:20288145-20288167 AGAAGGATAGAGAACAATGGAGG - Intergenic
1187613514 X:20968622-20968644 AAAAGGAAACAAAAGAAAATAGG + Intergenic
1187619700 X:21038155-21038177 AGAAGCAAAGAGTAGAATGGTGG - Intergenic
1188036459 X:25322937-25322959 AAAAGGAGAAAGAGGAAGGGAGG - Intergenic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188146840 X:26624654-26624676 AAAAGAAAACAAAAAAATGCTGG + Intergenic
1188175177 X:26980530-26980552 ACAAAGAGACAGAAAAATGGTGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188297950 X:28472773-28472795 AAAAGAAATCAGAAAAATGACGG + Intergenic
1188457557 X:30384168-30384190 AAAGGGAAAAAGATGAAAGGTGG - Intergenic
1188694404 X:33172225-33172247 CAAAGGAAATAAAAGTATGGCGG - Intronic
1188767763 X:34117548-34117570 CAAAGGGAGCAGAAGAAGGGAGG + Intergenic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1188890221 X:35602532-35602554 AAATGAAAACAGAACAATAGAGG - Intergenic
1188894414 X:35649356-35649378 AGGAGGAAATAGAAAAATGGAGG + Intergenic
1188921322 X:35981470-35981492 AACAGGAAACATAAGAAAGCTGG + Intronic
1188929683 X:36091818-36091840 AAAAAGAAAAAGGAAAATGGAGG - Intronic
1189028646 X:37427639-37427661 AGAAGCAAAGAGGAGAATGGTGG - Intronic
1189117957 X:38362840-38362862 AAAAGGAAACAGGAAAGAGGAGG - Intronic
1189120254 X:38386485-38386507 AAAAGGAGAAAGTAGAATGGTGG - Intronic
1189224954 X:39404894-39404916 AGAAGCAAAGAGTAGAATGGTGG - Intergenic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189537315 X:41948932-41948954 AAAAACAAAAAAAAGAATGGGGG - Intergenic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189751466 X:44226903-44226925 AAAAAGAAAAAGAAGAAGGAAGG + Intronic
1189764734 X:44358967-44358989 AAAAGCAGAAAGTAGAATGGTGG + Intergenic
1189774109 X:44454972-44454994 AAAAGAAAACAGAAAAAAGCTGG - Intergenic
1189997202 X:46650465-46650487 AGAAGGAAAAAGAAAAATGAAGG - Intronic
1190009926 X:46775678-46775700 AGAAAGAAAGAGAAGAAAGGAGG - Intergenic
1190250673 X:48722223-48722245 TAAAGGCAAAAGCAGAATGGAGG + Intergenic
1190382221 X:49850606-49850628 AGAAGGAGAGAGTAGAATGGTGG + Intergenic
1190876143 X:54461629-54461651 AAAAGAAAAAAGAAAAATAGGGG + Intronic
1191102608 X:56748267-56748289 CAAGGGAAACAGAATAATAGAGG + Intergenic
1191237344 X:58144747-58144769 AAAAGAAAAAAAAAGAATGTTGG - Intergenic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1191779516 X:64850444-64850466 AAAAGCTAACAGAAGAAAGATGG - Intergenic
1191906737 X:66101238-66101260 AAAAAGAAAAAGAAAAATGTAGG - Intergenic
1192007028 X:67226811-67226833 AAAAGCAGAGAGAAGAATAGTGG + Intergenic
1192228343 X:69245526-69245548 AAAAGCAAACTGCAGAATAGCGG + Intergenic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1192465203 X:71350096-71350118 AAAAAGAAAAAGAAGAAACGTGG - Intergenic
1192475735 X:71440907-71440929 AGAAGGAGAAAGAAGAAGGGAGG - Intronic
1192540208 X:71962609-71962631 AAAAGGAAAGAGATGAAAGTGGG - Intergenic
1192845431 X:74902485-74902507 AAAAGGTAACAGAAGGATTGGGG + Intronic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1192986410 X:76404363-76404385 AAAAGTAGAAAGCAGAATGGTGG + Intergenic
1193266324 X:79474461-79474483 AAAAGTAAACAGATGAATAAAGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1193685672 X:84573832-84573854 AAAAAGAAAAAGAAAAAAGGAGG + Intergenic
1193812184 X:86064690-86064712 AGAAGCACAGAGAAGAATGGTGG - Intergenic
1193886909 X:86993865-86993887 AAAAGGAGAGGGAAGAATGGGGG + Intergenic
1194122193 X:89975290-89975312 AAAAGGAAAAAAGAGAAAGGAGG - Intergenic
1194216300 X:91134077-91134099 AGAAGGAAACAGAAAAATGTGGG + Intergenic
1194795223 X:98202696-98202718 AAGAAGAAGAAGAAGAATGGGGG + Intergenic
1194843515 X:98775334-98775356 AGAAGAAGACAGAAAAATGGGGG + Intergenic
1194970055 X:100333024-100333046 AAAAGAAAAGAAAAGAAAGGAGG + Intronic
1195429686 X:104774681-104774703 GATAGGAAGCAGAAGAGTGGTGG + Intronic
1196043953 X:111236483-111236505 ACATAGAAACAGTAGAATGGCGG - Intergenic
1196101537 X:111852429-111852451 AAATGAAACCTGAAGAATGGAGG + Exonic
1196253353 X:113487246-113487268 AAAAGGAAAAAGGGTAATGGTGG - Intergenic
1196320324 X:114280280-114280302 AAAAGCAGACAGTAGCATGGTGG - Intergenic
1196381669 X:115098090-115098112 ATAACTAAACAGTAGAATGGTGG + Intergenic
1196536000 X:116845212-116845234 AAACTCAAACAGAAGAAAGGTGG + Intergenic
1196540205 X:116899170-116899192 AAAAGGGACAAGAAGAATGGTGG - Intergenic
1196555398 X:117079181-117079203 ATAAGGGAGCAGAAAAATGGAGG - Intergenic
1196644981 X:118108422-118108444 AAAAGGCAAGTGAAGAAAGGGGG - Intronic
1196846937 X:119903935-119903957 AAAAATAAACAAAATAATGGTGG - Intronic
1196889680 X:120279971-120279993 AAAAGGAAAGAAAAGAAGGAAGG - Intronic
1197056998 X:122133936-122133958 AAAAAGAAACAGAAAAAATGTGG + Intergenic
1197062867 X:122202160-122202182 AGAAGCAAAAAGTAGAATGGTGG + Intergenic
1197197817 X:123720869-123720891 AGAAGCAAAAAGTAGAATGGTGG + Intronic
1197215722 X:123864980-123865002 AAAAAAAAAAAGAAGAAAGGCGG - Intronic
1197240246 X:124115806-124115828 AAAAAAAAAAAAAAGAATGGAGG - Intronic
1197399017 X:125965888-125965910 AAAAGCAGAGAGTAGAATGGTGG - Intergenic
1197464465 X:126785564-126785586 AAAAAAAAATAGAAGGATGGTGG + Intergenic
1197483593 X:127018834-127018856 GCAAGGAAACAAAAGAAAGGAGG - Intergenic
1197509238 X:127350490-127350512 AAAAGGACAGAGAACAAAGGAGG - Intergenic
1197549391 X:127870261-127870283 AAGAGCAGACAGCAGAATGGTGG + Intergenic
1197861741 X:130978329-130978351 AATAGGAAAGAGAGTAATGGGGG - Intergenic
1197920262 X:131584725-131584747 AAAAAAAAAAAGCAGAATGGAGG + Intergenic
1197922016 X:131604835-131604857 AAAAGTAGACAATAGAATGGTGG - Intergenic
1197928297 X:131670134-131670156 AAAAAAAAAAAAAAGAATGGTGG + Intergenic
1197979899 X:132206178-132206200 AAAAGAAAAGAGAAGAAAGAGGG + Intronic
1198210951 X:134515506-134515528 AAAAAGAAAGAGAAAAAGGGAGG + Intronic
1198228779 X:134670236-134670258 AGCAGGAAACAGATGCATGGAGG - Intronic
1198229152 X:134673218-134673240 AGAAGGAAAGGAAAGAATGGAGG + Intronic
1198380325 X:136077651-136077673 AAAAGGAAAGAGAAAAAATGGGG - Intergenic
1198491095 X:137142339-137142361 AAAAAGTAAGAGAAGAAGGGAGG - Intergenic
1198509761 X:137338424-137338446 AAATGGAAAAAAAAGAATGCAGG + Intergenic
1198716956 X:139567762-139567784 AAAAAGAAAAAGAGGAAGGGAGG + Intergenic
1198738637 X:139816295-139816317 AAATGGAAACAGGAAATTGGAGG - Intronic
1198849977 X:140955582-140955604 AAAACAAAAAAAAAGAATGGTGG + Intergenic
1198974867 X:142325382-142325404 AAATGGAAACAGAAAAAAGCAGG - Intergenic
1199007117 X:142713485-142713507 AGAAGTAAAGAGAAGAATAGTGG + Intergenic
1199179678 X:144838717-144838739 CAAAGGGAACAGATGAATGAGGG + Intergenic
1199583469 X:149385575-149385597 AAAAGCACATAGAAGAAGGGGGG + Intergenic
1199866860 X:151859398-151859420 AAAAGTAAAAAGTAGAATAGAGG + Intergenic
1200053781 X:153447923-153447945 AAAAGAAACCAAAAGGATGGTGG + Intronic
1200475047 Y:3632724-3632746 AAAAGGAAAAAAGAGAAAGGAGG - Intergenic
1200670484 Y:6082412-6082434 AAAAGGAACCTGAAGAAAGAGGG - Intergenic
1200797466 Y:7354371-7354393 AAAAGGATAAAGAAGAACAGAGG - Intergenic
1200867272 Y:8058354-8058376 AAAAGAAAACAGTACAAAGGTGG + Intergenic
1200969726 Y:9138246-9138268 CAAAGGAAAAAAAAGAATAGCGG + Intergenic
1201253902 Y:12088419-12088441 AAGGGGAGAGAGAAGAATGGAGG - Intergenic
1201454411 Y:14153995-14154017 AAAAGGACACAAACAAATGGAGG + Intergenic
1201491947 Y:14551107-14551129 AAATGGAAAGAAAAGAAAGGAGG + Intronic
1201897265 Y:19005393-19005415 AAAAGGAAAAAAAAAAAAGGTGG - Intergenic
1202304507 Y:23454156-23454178 AAATGAAAGCAGAGGAATGGTGG + Intergenic
1202566303 Y:26216435-26216457 AAATGAAAGCAGAGGAATGGTGG - Intergenic