ID: 1004425366

View in Genome Browser
Species Human (GRCh38)
Location 6:15503469-15503491
Sequence GCGTCCCCCTAGAAGTGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004425366_1004425370 1 Left 1004425366 6:15503469-15503491 CCCTATCACTTCTAGGGGGACGC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1004425370 6:15503493-15503515 GCGGTGTCCAGTGCTCCGCAGGG No data
1004425366_1004425369 0 Left 1004425366 6:15503469-15503491 CCCTATCACTTCTAGGGGGACGC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1004425369 6:15503492-15503514 TGCGGTGTCCAGTGCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004425366 Original CRISPR GCGTCCCCCTAGAAGTGATA GGG (reversed) Intronic
901821129 1:11830087-11830109 GCGCCCCCCAAGAAGGGAAAAGG - Intronic
1066745792 10:38603669-38603691 GCCTTCCCCCAGAAGAGATATGG - Intergenic
1067797371 10:49330493-49330515 GAGTCCACCTAGAAGTAAGAGGG - Intergenic
1079208805 11:18441960-18441982 GTGTGCCCCAAGCAGTGATAGGG - Intronic
1095389353 12:41687353-41687375 TCTTCCCCCTAGAAGTTGTAGGG + Intergenic
1098881574 12:75922653-75922675 GTGTCTTTCTAGAAGTGATAAGG + Intergenic
1104625631 12:130351885-130351907 CCTTCCCCCCAGAAGTGATGTGG + Intronic
1107558611 13:41540681-41540703 GCCTCACCCTGGAAGTGAAAGGG - Intergenic
1121751812 14:96363602-96363624 GCGGCCCCCGAGAAGGGCTAGGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1136737272 16:32475979-32476001 GCCTTCCCCTAGAAGAGATATGG + Intergenic
1140172002 16:72615488-72615510 CCCTCCCCCTAGAACTTATAAGG + Intergenic
1203015798 16_KI270728v1_random:353598-353620 GCCTTCCCCTAGAAGAGATATGG - Intergenic
1203034133 16_KI270728v1_random:626756-626778 GCCTTCCCCTAGAAGAGATATGG - Intergenic
1157594731 18:48857695-48857717 TCGTGCCCCTAGAACTGTTAAGG - Intronic
933993790 2:87652610-87652632 GTGTCCCCCCAGAATTCATATGG - Intergenic
934188403 2:89765094-89765116 GCCTTCCCCCAGAAGAGATATGG + Intergenic
934308195 2:91842861-91842883 GCCTTCCCCCAGAAGAGATATGG - Intergenic
936300073 2:111298273-111298295 GTGTCCCCCCAGAATTCATATGG + Intergenic
952967204 3:38628717-38628739 TAGTTCCCCTAAAAGTGATAAGG - Intronic
959824568 3:110778315-110778337 ACCTTCCCCTAGAAGTGATTGGG + Intergenic
967844652 3:194034184-194034206 GCGTCCCCCAGGAAGGGATATGG + Intergenic
1001734598 5:173988547-173988569 GCGTCTCCCTAGTAGTGACCTGG + Intronic
1004425366 6:15503469-15503491 GCGTCCCCCTAGAAGTGATAGGG - Intronic
1007162012 6:39799172-39799194 GCTACCCCCTAGAAGTGTTGTGG - Intronic
1010089114 6:71958755-71958777 GCTTCCCCCTTGACCTGATAGGG - Intronic
1014282532 6:119457700-119457722 GAGTCCCCTTGGAAGTGATGTGG + Intergenic
1035235201 7:157493318-157493340 GCATCTTCCTAGAAGGGATATGG - Intergenic
1052022431 9:23540717-23540739 ACATCTTCCTAGAAGTGATAAGG + Intergenic
1053647354 9:40131213-40131235 GTGTCCGCCTTGAAGTGAAAGGG - Intergenic
1053758373 9:41332630-41332652 GTGTCCGCCTTGAAGTGAAAGGG + Intergenic
1054537225 9:66244957-66244979 GTGTCCACCTTGAAGTGAAAGGG + Intergenic
1200111401 X:153742791-153742813 GCCTTCCCCCAGAAGAGATACGG - Intronic
1201599544 Y:15713182-15713204 GCCTCCCCCAAGAAGTGCAAGGG + Intergenic