ID: 1004426337

View in Genome Browser
Species Human (GRCh38)
Location 6:15509697-15509719
Sequence CTGTGGCATGGCCTGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004426328_1004426337 24 Left 1004426328 6:15509650-15509672 CCTCCGGAAGAAGAGCGTGGCCA 0: 1
1: 0
2: 2
3: 2
4: 68
Right 1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 244
1004426326_1004426337 30 Left 1004426326 6:15509644-15509666 CCTTTGCCTCCGGAAGAAGAGCG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 244
1004426334_1004426337 -2 Left 1004426334 6:15509676-15509698 CCTGTGGAGGAGTTACACTGGCT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 244
1004426329_1004426337 21 Left 1004426329 6:15509653-15509675 CCGGAAGAAGAGCGTGGCCATTT 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 244
1004426332_1004426337 4 Left 1004426332 6:15509670-15509692 CCATTTCCTGTGGAGGAGTTACA 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG 0: 1
1: 0
2: 2
3: 21
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004426337 Original CRISPR CTGTGGCATGGCCTGTGTTC TGG Intronic
900352649 1:2243188-2243210 CTGGGGCATGGGCCGTGTTTTGG + Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
901646555 1:10719941-10719963 CTGTCGGAGGACCTGTGTTCAGG - Intronic
901927321 1:12574614-12574636 CTGTGGCCTGGCCTGTCTCTTGG + Intronic
902877900 1:19352016-19352038 CTGTGGGGTTGCCTGGGTTCAGG - Intronic
903967928 1:27101530-27101552 GTGGGGCATGGCCTGGGTTAGGG - Intronic
904273310 1:29364411-29364433 CTGTGGCCTGGGCTTTCTTCTGG - Intergenic
904398395 1:30239249-30239271 CTGTGGTGAGGCCTGTGTTCAGG + Intergenic
905519828 1:38589232-38589254 CTCAGTCCTGGCCTGTGTTCAGG + Intergenic
905828992 1:41049126-41049148 CTGTGTCTTGGCCTTTGGTCTGG - Intronic
906543829 1:46607811-46607833 CTGTGGCAAGGGCTGATTTCTGG - Exonic
909674695 1:78226169-78226191 CTGGGCAATGGCCTGTATTCTGG + Intergenic
916833052 1:168512768-168512790 CTGTGGCATTGTTTGTTTTCAGG + Intergenic
917789685 1:178491607-178491629 CTCTAGTATGGCCTGAGTTCGGG - Intergenic
918413243 1:184282374-184282396 CTGTTGCAGGGCCTTTGTGCTGG - Intergenic
919817397 1:201450112-201450134 CTGTGCCAGGGCCAGTTTTCAGG + Intergenic
919841224 1:201610881-201610903 CTGTGGCATGGCCTCCTTTCTGG - Intergenic
922544616 1:226446688-226446710 CTGTGGGATGGCCAGTCTACAGG + Intergenic
922922693 1:229319999-229320021 CTGTGTTTTGGCCTGTGTTAAGG + Intergenic
923517691 1:234711178-234711200 CTGTGCTATGGCCTGGCTTCGGG - Intergenic
1064244967 10:13660935-13660957 CTGTGGGAGGGTCTGAGTTCTGG + Intronic
1065283255 10:24162454-24162476 CTGTGGCAGAGCCTGAGCTCAGG + Intronic
1067511355 10:46897489-46897511 CTGTAGCATGGGCTGTGCTCAGG + Intergenic
1067526196 10:47040173-47040195 CCATGGCAGGGCCTGTGCTCTGG + Intergenic
1067650892 10:48154373-48154395 CTGTAGCATGGGCTGTGCTCAGG - Intergenic
1067801704 10:49363519-49363541 CTGTGGCATGGCATGGAGTCAGG - Intergenic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1069369906 10:67736864-67736886 CTGTAGGATGTCCTGTGTGCTGG - Intergenic
1069765457 10:70853970-70853992 CTGCAGCATGGCCAGTTTTCTGG + Intronic
1070288325 10:75099429-75099451 CTGGGGCATGGCCTGGGGCCGGG + Intronic
1070299978 10:75196412-75196434 CTGTGGCCTGGCCTCTGTGGAGG - Intergenic
1070534173 10:77362653-77362675 CTGTGGCTTGTCCTGTGAGCTGG - Intronic
1073316413 10:102584023-102584045 CTGTGGCCAGTCCTGTTTTCTGG + Intronic
1075925482 10:126248433-126248455 GGGTGGCAAGGCCTGTGTTTGGG - Intronic
1076658748 10:132041431-132041453 CGGCAGCATGGGCTGTGTTCTGG + Intergenic
1076734483 10:132452609-132452631 CTCTGGAAAGGCCTGTGTCCTGG + Intergenic
1076826972 10:132974028-132974050 CTGTGGCCTGGCCTCTGGCCTGG - Intergenic
1077316308 11:1920856-1920878 CTGTGTCATTGCCTCTGTTGCGG - Intronic
1079075850 11:17385127-17385149 CTGTGGCAATGCCTGTGACCTGG - Intergenic
1081884102 11:46479949-46479971 GTGTTGGCTGGCCTGTGTTCGGG + Intronic
1083890460 11:65593228-65593250 CTGGGGCAGCGCCTGGGTTCTGG + Intronic
1083963278 11:66026270-66026292 CTGTGGCCTGGCCTGTGGTGTGG + Exonic
1084964885 11:72739334-72739356 GTGTGGTGTGGCCTGTCTTCTGG + Intronic
1085064512 11:73481753-73481775 CTGTGGCATGGCATCTGCTATGG + Intronic
1085339931 11:75724450-75724472 CTGTGGGAGGGCCTGTGTCTAGG + Intronic
1085509545 11:77081317-77081339 CTGTGGCCAGGCCTGTGTGGAGG + Intronic
1085637311 11:78168773-78168795 CTGTGAAATGCCCTGTGTTTTGG + Intergenic
1085997963 11:81944578-81944600 TAGGGGGATGGCCTGTGTTCAGG + Intergenic
1086066675 11:82752963-82752985 ATTTGGCATGGTCAGTGTTCTGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1091346758 11:134859445-134859467 CTGAGGGATAGGCTGTGTTCTGG + Intergenic
1091591390 12:1845013-1845035 CTGTGGGCTGCCGTGTGTTCAGG - Intronic
1091799171 12:3313895-3313917 CCGTGGCTTGTCCTGGGTTCAGG + Intergenic
1092067712 12:5605669-5605691 CTGTGGTGTGGCATGTGTTTCGG + Intronic
1096570558 12:52520703-52520725 CATTGGCATGGCCAGTGTCCTGG + Intergenic
1097692264 12:62744665-62744687 CTTTGTAATGGCCTGTGGTCAGG - Intronic
1097927473 12:65145481-65145503 CTGTGGCATAGCCTGTTTGCCGG + Intergenic
1098886980 12:75970146-75970168 CTGTGGCTGGGCCTGTGGTCTGG - Intergenic
1099883247 12:88495347-88495369 GTGTGGCATTGACTGTTTTCAGG - Intronic
1100181771 12:92093839-92093861 CTTTGGCATGGCATCTGTTCAGG + Intronic
1101758741 12:107642183-107642205 GTGTGGCCTGGCCTCTGTGCTGG + Intronic
1101918382 12:108913391-108913413 CTGTGGCATGGCATCTGTGTTGG - Intronic
1105284518 13:18993477-18993499 CTCTGGCCTGGCCTTTCTTCTGG - Intergenic
1110203013 13:72875597-72875619 ATTTGGCATTGCCAGTGTTCTGG + Intronic
1110425766 13:75364489-75364511 CTGAGACATGGCAAGTGTTCAGG - Intronic
1111182241 13:84684798-84684820 CTTTGCCATTGCCTGTGGTCTGG + Intergenic
1112804163 13:103144593-103144615 GTGTGGAATGGTCAGTGTTCTGG + Intergenic
1113068730 13:106397266-106397288 CTGTGAGATGGCCTGTGTGGAGG - Intergenic
1113737407 13:112688838-112688860 CTCTGGCCTGCCCTGTGCTCAGG - Intergenic
1113940441 13:114015989-114016011 CTTTGGCCTGGCCTGTGTGCCGG - Intronic
1114215643 14:20655865-20655887 CTGTGGCATCGCCAGTGCCCAGG - Intergenic
1114862737 14:26545520-26545542 CTGTGTCATGGTGTGTGTTCTGG - Intronic
1118571211 14:67197336-67197358 CTGTGGCTCGGCCTGAGTTGAGG + Exonic
1119214181 14:72856057-72856079 CTGTGGCCTGGCCTGTGCTTTGG + Intronic
1121541297 14:94728773-94728795 CTCTTCCATGGCCTGGGTTCTGG + Intergenic
1121744470 14:96277488-96277510 CTTGGGCATGGCCTGTGCTTTGG + Intergenic
1121879652 14:97488630-97488652 ATGTGGCATGGCCTGCCCTCTGG - Intergenic
1123139297 14:106059883-106059905 CTGTGGCATGGCGTGTGCTGAGG + Intergenic
1123207324 14:106726131-106726153 CTGTGGCATGGCAGGTGCTGAGG + Intergenic
1123212342 14:106773125-106773147 CTGTGGCATGGCGTGTGCTGAGG + Intergenic
1127261341 15:57328940-57328962 CAGTGGCATGGCCTCTTCTCTGG + Intergenic
1129705191 15:77790390-77790412 ATGTAGGATGGGCTGTGTTCTGG + Intronic
1130166140 15:81461063-81461085 CTGGGCTATGCCCTGTGTTCTGG - Intergenic
1130766848 15:86879448-86879470 CTGGGGCTTGGCCTGAGTCCAGG + Intronic
1130856445 15:87843537-87843559 TGGTGGCTTGGCCTGCGTTCAGG + Intergenic
1131621558 15:94073411-94073433 CTGAGGCATGGGCTGTGGCCTGG + Intergenic
1132040994 15:98524555-98524577 CTGTCGCTGGCCCTGTGTTCTGG + Intergenic
1132336587 15:101051981-101052003 CTGTGACCTGCACTGTGTTCTGG - Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133235177 16:4384349-4384371 CTGTGGCCTGGACTGGGTGCAGG + Intronic
1134073257 16:11273534-11273556 CTGTGGCCTGGGCTGTGGCCTGG + Exonic
1135745055 16:25010004-25010026 CTGAGGCATGGCTTGGGTCCAGG - Intronic
1138206056 16:55126029-55126051 CTTTGGCATGGGCTGTCTGCAGG + Intergenic
1139256545 16:65548351-65548373 CAGTGGAAAGGCCTGTGTCCAGG - Intergenic
1139632899 16:68241258-68241280 CAGTGGCATGATCTCTGTTCTGG + Intergenic
1140430137 16:74895866-74895888 CTATGGCAGGGCCTGTTTTAGGG + Intronic
1141480332 16:84302056-84302078 CTGTGCAATGGCGTGTGTCCAGG - Intronic
1141983149 16:87562225-87562247 CTGTGGCACGGCCTGGGTGCAGG + Intergenic
1142068169 16:88074546-88074568 CAGTGGCCAGACCTGTGTTCTGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142535532 17:615389-615411 CTGTGGCAGGTCTTGTCTTCCGG + Intronic
1142839615 17:2617473-2617495 CTGAGGGATGGACTGTGCTCAGG - Intronic
1142995138 17:3755514-3755536 CTGTTGCCTGGTCTGTATTCAGG + Intronic
1143339674 17:6200921-6200943 CTGTGCAATGGCCTGTGCACTGG - Intergenic
1143861531 17:9894772-9894794 CTGTGGCCTCGCCTGTGATTAGG + Intergenic
1144666803 17:17107589-17107611 CTGTGGCCTGGCCTGTATTCAGG + Intronic
1145067452 17:19771474-19771496 GTGGGGCAAGGCCTGTCTTCAGG - Intronic
1148080212 17:44963861-44963883 ATGTGCCAGGGCCTGTGGTCAGG - Intronic
1148625894 17:49068726-49068748 CTTGGGCATGGCCTGGGCTCTGG - Intergenic
1150560735 17:66292416-66292438 CCATGGCATAGCCTGTGTTTTGG - Intergenic
1151884651 17:76916381-76916403 CTCTGGCCTGGCCTGTGTTGGGG + Intronic
1151967121 17:77437270-77437292 CTGTGGTTTGGCCTGAGTCCAGG + Intronic
1151987755 17:77555184-77555206 CTGGGCCATGGCCTGTGGACTGG - Intergenic
1152242005 17:79165754-79165776 CTGTGACCTGGCCTGACTTCTGG - Intronic
1152561730 17:81082012-81082034 GTGTGGCAGGGCCTGGGCTCTGG + Intronic
1153408823 18:4770659-4770681 CGGGGGCCTGGCCTGTTTTCTGG + Intergenic
1153863109 18:9234148-9234170 TGGTGGCATGGCCTTTGTGCTGG - Intronic
1154530091 18:15334022-15334044 CTGTCGCATTGCCTGAGCTCAGG + Intergenic
1158686971 18:59623378-59623400 CTGAGGCATGGTGTGTGGTCAGG + Intronic
1159020707 18:63141011-63141033 AGGTGGCATGGTTTGTGTTCTGG + Intronic
1160437800 18:78865242-78865264 CTGTGGCCTGGTCTGTGGCCAGG - Intergenic
1160464802 18:79067976-79067998 CTGTGGAGTGGCATGTATTCAGG + Intergenic
1160906865 19:1455731-1455753 AGGTGGCATGGCCTGTGGGCAGG + Intronic
1160926952 19:1551038-1551060 CTGAGGCCTGGCCTGTGTCCTGG - Intergenic
1161176228 19:2843822-2843844 CTGAGGCAGCCCCTGTGTTCGGG - Intronic
1161589309 19:5121869-5121891 CTGTGGCAAGCCCTGCCTTCTGG - Intronic
1163746677 19:19052805-19052827 CTGTGGCCAGGCCTGTGTGGGGG + Intronic
1163824732 19:19516581-19516603 CTGAGTCATAGCCTGTGCTCTGG + Intronic
1165481622 19:36067893-36067915 CTGTGGTGTGGCCTGCGGTCGGG + Exonic
1166290639 19:41860971-41860993 GTGAGGCCTGGCTTGTGTTCCGG + Intronic
1168311549 19:55463431-55463453 CTCTGGCTTGTCCTGGGTTCTGG + Intergenic
925119173 2:1404076-1404098 CTTTGGCATGATCTGTGCTCGGG - Intronic
925575523 2:5356144-5356166 CTTTGGCATGGATCGTGTTCAGG - Intergenic
926450779 2:13001104-13001126 CTGTTTCATGGCCCATGTTCAGG - Intergenic
927113179 2:19878693-19878715 GTGAGGAATGGCCTGTGTTTGGG + Intergenic
929997784 2:46839798-46839820 CTCTTGCCGGGCCTGTGTTCTGG - Intronic
930021208 2:47003282-47003304 CTGAGGCATGGGCTGGGTTGGGG + Intronic
932824920 2:74930374-74930396 CTGTGGCTTGGGCTCTGTGCAGG + Intergenic
933969294 2:87457286-87457308 GTGTGGCAGGGCCTGAGATCCGG - Intergenic
934073843 2:88410318-88410340 CAGTGGCCTGGCCTGTGCCCTGG - Intergenic
935386529 2:102505172-102505194 CTGTGGCATTGCCTGTGGGGAGG + Intronic
937125685 2:119473819-119473841 CGGTGGCAGGGCCTGGGATCAGG - Intronic
937516689 2:122663619-122663641 CTGTGGCACTGCCCGTGTCCAGG - Intergenic
938194625 2:129315652-129315674 CTTTGTAATGGCCTGTGGTCAGG + Intergenic
938407075 2:131038675-131038697 CTGGGGCAGGGGCTATGTTCTGG - Intronic
942508783 2:176673536-176673558 CTGTGGCACAGCCTGTGTGCTGG + Intergenic
943375707 2:187073882-187073904 CTATAGCATGTCCTGTGATCAGG - Intergenic
945883370 2:215349869-215349891 CTGTGGGATGGGCTGAGCTCCGG - Intergenic
948148773 2:235728532-235728554 CTGAGGCAGGGTCTGTGTGCAGG + Intronic
948640869 2:239375350-239375372 CCGTGGCCTGGCAGGTGTTCAGG - Intronic
949007675 2:241658952-241658974 CTGTGGCATTGGCTGTGCCCCGG + Intronic
1168835113 20:872757-872779 CTGTGACATGGAGGGTGTTCGGG - Exonic
1169183500 20:3592007-3592029 CTGTGGCATTGCCTGTGGTCAGG + Intronic
1171416140 20:24981942-24981964 ATGGGGCATGGCCTGTGTTGTGG + Intronic
1171419194 20:25006536-25006558 TTGTGGCAGTGCCAGTGTTCGGG - Exonic
1171471605 20:25376557-25376579 CTGTGGTACGGCATGTTTTCAGG + Intronic
1171492820 20:25533090-25533112 GTGTTGCCTGGGCTGTGTTCTGG - Intronic
1174367554 20:50065606-50065628 CTGGGTCATTGCCTGTGGTCAGG + Intergenic
1174375055 20:50121036-50121058 CTGTGGGATGGCTTGGTTTCAGG - Intronic
1174853583 20:54021082-54021104 CTGTGGCATGTCCTCTTTGCTGG + Intronic
1175388204 20:58610658-58610680 CAGTGGAATGGCCTGTGCTAAGG - Intergenic
1179307183 21:40165411-40165433 TTGTGGCATGGCCTGTCAGCAGG - Intronic
1179307837 21:40170874-40170896 CTGGGGCATGGCCTTTGGTGTGG + Intronic
1180962382 22:19767699-19767721 CTGCGCCCTGGCCTGTTTTCGGG + Intronic
1181140778 22:20803339-20803361 CTGTCACATGGCCTGTGGTATGG + Intronic
1184021664 22:41825580-41825602 CTGGGGCAGGGCCTGTGTCCAGG + Intronic
954690588 3:52393529-52393551 CTGTGGCAGGGCCTGAGAACAGG + Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954983240 3:54765268-54765290 CTGTGGCCTGGCCTGTGTCATGG - Intronic
956218371 3:66873788-66873810 CTGTGGCATGATCTCTGGTCAGG + Intergenic
964347947 3:155773665-155773687 CTGTGGCATTGCATGATTTCAGG + Intronic
965732245 3:171784538-171784560 CTGGGACATGGCATGTGTGCAGG - Intronic
967654489 3:192030458-192030480 CTGAGCCTTGGCCTGTTTTCAGG + Intergenic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968615821 4:1577330-1577352 CAGAGGCAGGGCCTGTGCTCAGG + Intergenic
968684385 4:1947181-1947203 CTGTGGGATGGCCGCTGCTCAGG + Intronic
970257370 4:14182710-14182732 CTGCTGCATGGGTTGTGTTCTGG - Intergenic
970421702 4:15911067-15911089 CTGTGTCAGGTGCTGTGTTCAGG + Intergenic
971452127 4:26810046-26810068 CTGTGGCCTGCCCTGTGTGAGGG - Intergenic
971953330 4:33382924-33382946 CTGAGGCCTGGGCTGTGTTTGGG - Intergenic
972863981 4:43207668-43207690 CTGTGGCCTGGTCTTTGGTCAGG - Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
976893464 4:90079109-90079131 GTGTGCCAAGGCCTGTGGTCGGG + Intergenic
978318572 4:107467501-107467523 CTGTGGCCTGCCTTGTGTTTGGG - Intergenic
978319537 4:107478791-107478813 CTCTGGCATGCCCTGAGGTCAGG + Intergenic
980175104 4:129335336-129335358 CTGTGGTGTAGCCTGTTTTCAGG + Intergenic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
981158477 4:141469210-141469232 CTGTGGCATTACATGTCTTCAGG + Intergenic
983312246 4:166079746-166079768 CTGTGCCATTGTCTGTCTTCTGG + Intronic
983891731 4:173036698-173036720 GGATGGCATGGCCTGTGCTCTGG - Intronic
985352874 4:189084901-189084923 CTGTCACATGTCCTGTGTTGCGG + Intergenic
985676639 5:1234841-1234863 CTGTGGCATGGGCAGTGGCCCGG + Intronic
987836325 5:23168166-23168188 CTGGGACATGGCCTGGGGTCTGG - Intergenic
994399008 5:99256158-99256180 CTGTGATATGACCTGTATTCAGG + Intergenic
997446718 5:133945665-133945687 CTGTGGCATGCTATGTTTTCTGG + Intergenic
998567495 5:143229371-143229393 TGGGGGCATTGCCTGTGTTCTGG - Intergenic
998883548 5:146670153-146670175 CTGTGTAATGTCCTGTGTCCTGG - Intronic
999136083 5:149320224-149320246 TTGTGTCATGGGCTGTGTTAGGG - Intronic
999288832 5:150410146-150410168 GGGTGGCCTAGCCTGTGTTCAGG + Intronic
999387475 5:151164783-151164805 CTGTGGAGTGGCCTGTCTACAGG + Intergenic
999552232 5:152701898-152701920 CTGTGGAGTCACCTGTGTTCTGG - Intergenic
1001205607 5:169759891-169759913 CTGTGGCAGGGGATGTTTTCAGG + Intronic
1002987424 6:2204167-2204189 CTGTGGGCTGGTCTGTGATCGGG + Intronic
1003414687 6:5897301-5897323 CTGGGGCCTGGGCTGTGGTCAGG + Intergenic
1003799773 6:9650662-9650684 TAGTGACATGGCCTGTGTTTGGG + Intronic
1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG + Intronic
1005013973 6:21360364-21360386 CTGTTGCATGGGCTGTGCGCTGG + Intergenic
1006174887 6:32115816-32115838 CTGTGGCATTGCCTGGGGTTGGG + Exonic
1006841090 6:37028201-37028223 CTGTGGCAGGAGCTGGGTTCAGG - Exonic
1008474097 6:51917711-51917733 ATGTGGCATGGCCAGAGTACAGG + Intronic
1010578558 6:77564926-77564948 CTGAAGCATGACCTCTGTTCTGG - Intergenic
1011333278 6:86233908-86233930 CTGTGGCTAGGCTTGTATTCAGG + Intergenic
1017215364 6:151900782-151900804 CTGTGCTATGGGCTGTTTTCAGG + Intronic
1017498860 6:155005266-155005288 CTCTGGCATAGCCTGTACTCAGG - Intronic
1017539004 6:155380609-155380631 CTATGGCATTGCCTGTGATTGGG - Intergenic
1017805697 6:157943695-157943717 CTGTGCGGAGGCCTGTGTTCGGG + Exonic
1018346212 6:162901634-162901656 CTGTGGCACCGCCTTTGCTCAGG + Intronic
1019351151 7:554656-554678 CTGTGGCCTCCCCTGTCTTCTGG - Intronic
1019804067 7:3109849-3109871 CTGGAGGATGGCCTGTGCTCAGG + Intergenic
1019999489 7:4747218-4747240 CTGTTGCATGGCTTCTGTGCGGG + Intronic
1022384781 7:29890758-29890780 CTCAGGCCTGCCCTGTGTTCAGG + Intronic
1023393378 7:39731408-39731430 ATCTGGCTAGGCCTGTGTTCAGG + Intergenic
1023465818 7:40453303-40453325 CTGTTGCATGGCCTCTGCCCTGG + Intronic
1023562413 7:41489907-41489929 CTCTGGCAAGTTCTGTGTTCAGG - Intergenic
1024393390 7:48840049-48840071 CTGTTTGATGGCCTGTGCTCTGG - Intergenic
1024502907 7:50131824-50131846 CTGTGTCATGCCATGTGTTTTGG - Intronic
1025957717 7:66195638-66195660 CTTTGGCAAAGCCTGTGTGCTGG + Intergenic
1027126129 7:75557987-75558009 CTGTGTCTTGGGCTGTGTCCTGG - Intronic
1027901679 7:84124078-84124100 CAGTGGCATGTCCTGGTTTCTGG + Intronic
1031728415 7:125266244-125266266 CAGTGGCATGGCCTTTGGTGAGG - Intergenic
1032320841 7:130885263-130885285 CTGTGGCCTCAGCTGTGTTCTGG - Intergenic
1032331778 7:130987192-130987214 CTGAAGCATGGCCTGTCTTGGGG + Intergenic
1034058839 7:148067439-148067461 CTGTGACATGATCTGTCTTCAGG + Intronic
1034448338 7:151124672-151124694 GCGTGGCAAGGCCTGTGGTCAGG + Intronic
1035221301 7:157407973-157407995 CGCGGGCATGGCCTGTGTGCTGG + Intronic
1035732881 8:1865326-1865348 CTGGGGGATGCCCTGTGTCCTGG - Intronic
1037582409 8:20253425-20253447 CTGAAGCCTGGCCTGTGCTCTGG - Exonic
1038770566 8:30475499-30475521 CTCTGGAAGGGCCTGTGCTCAGG + Intronic
1039061083 8:33572712-33572734 CTGTGCCAAGCCCTGTGCTCAGG + Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1040497278 8:47977381-47977403 CTGGGGCATGGTTTGTGTGCTGG + Exonic
1043121814 8:76335453-76335475 TTCTAGCATGGCCTGTGTTCAGG - Intergenic
1043629314 8:82308682-82308704 GTGTGGCAGGGGCTGAGTTCTGG - Intergenic
1045506100 8:102779828-102779850 CTGTGGCAGGGACTGTCTTTCGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048934222 8:139341891-139341913 CTGTGTCCTGCCCTGTGTCCTGG - Intergenic
1049700947 8:144012290-144012312 CCGAGGCAAGGCCTGTGTACAGG + Intronic
1052130968 9:24846259-24846281 CTGTGGGTTGGCCCATGTTCTGG + Intergenic
1054757460 9:68973745-68973767 CTGGGGCCTGGCTGGTGTTCAGG - Intronic
1054937908 9:70709073-70709095 CTGTTGAATGGCCTCTATTCAGG + Intronic
1054939599 9:70727066-70727088 CTGTTGAATGGCCTCTATTCAGG + Intronic
1056623601 9:88235806-88235828 CTGTGGCTTGGCCTGTTGCCTGG + Intergenic
1060280765 9:122214139-122214161 CTGGGGCGTGGCCTGTGGACTGG - Intronic
1060664807 9:125426440-125426462 CTGTGGCTCTGTCTGTGTTCTGG + Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061373417 9:130210570-130210592 TTGGGGCATGGCCAGTGCTCAGG + Intronic
1062081040 9:134623573-134623595 CTATGACAGGTCCTGTGTTCCGG + Intergenic
1062180670 9:135189427-135189449 CTGTGGCATGGGGTGTGGTGTGG - Intergenic
1187062298 X:15798718-15798740 TTGTGGAATGCCCTGTATTCTGG + Intronic
1187954085 X:24498532-24498554 CTGAGCCATTCCCTGTGTTCAGG + Intronic
1188882598 X:35507826-35507848 CTGTGGCTTGGACTGTGATAGGG - Intergenic
1189551352 X:42096775-42096797 CTGTGGCATGGCCAGCCTGCAGG + Intergenic
1190320945 X:49178873-49178895 CAGTGGCAGGGCCTGTCTGCAGG - Intronic
1194967409 X:100304221-100304243 CTGTGACATGATCTGTCTTCAGG - Intronic
1195652906 X:107304315-107304337 CTGTGGCATGTGCTGGGTTTAGG + Intergenic
1199824899 X:151489245-151489267 CTGTGGCATGGCATGTACTGTGG - Intergenic