ID: 1004426571

View in Genome Browser
Species Human (GRCh38)
Location 6:15510895-15510917
Sequence TGGCCTCTGTTAACAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004426567_1004426571 12 Left 1004426567 6:15510860-15510882 CCTTGTGAGGACATTATCAGGTG 0: 1
1: 0
2: 1
3: 21
4: 153
Right 1004426571 6:15510895-15510917 TGGCCTCTGTTAACAGAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 143
1004426563_1004426571 30 Left 1004426563 6:15510842-15510864 CCGAGGGAGCCACGTATTCCTTG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1004426571 6:15510895-15510917 TGGCCTCTGTTAACAGAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 143
1004426565_1004426571 21 Left 1004426565 6:15510851-15510873 CCACGTATTCCTTGTGAGGACAT 0: 1
1: 0
2: 2
3: 11
4: 100
Right 1004426571 6:15510895-15510917 TGGCCTCTGTTAACAGAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004426571 Original CRISPR TGGCCTCTGTTAACAGAAGG AGG Intronic
900992572 1:6104687-6104709 TGGACTCTGTTACCAGTGGGGGG - Exonic
906289929 1:44613243-44613265 TGGCCTCTGCTTACAGGAGTGGG - Intronic
907374123 1:54021711-54021733 CGGCCTCACTTTACAGAAGGGGG + Intergenic
910218828 1:84868744-84868766 TGGTCTCTGCTTCCAGAAGGGGG - Intronic
912142823 1:106752415-106752437 TAATCTTTGTTAACAGAAGGAGG - Intergenic
914424797 1:147565901-147565923 TGGCCTCTGGTAAGAGGATGGGG - Intronic
914918909 1:151834450-151834472 TGGCCTTTGTGACAAGAAGGGGG - Intergenic
915021760 1:152786313-152786335 TGTCCTCTGGGAACAGAAGCAGG + Intronic
916806322 1:168264945-168264967 CCTCATCTGTTAACAGAAGGAGG + Intergenic
919034053 1:192283215-192283237 GTGACTCTGTTAAAAGAAGGTGG + Intergenic
922763720 1:228147211-228147233 TGGCCTCTGTTCCCTGTAGGCGG + Intronic
922884994 1:229012614-229012636 TGGGCTCTGTTATCAGATGGTGG + Intergenic
1063466722 10:6250698-6250720 TGTCCTCAGATCACAGAAGGTGG - Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1064553204 10:16522308-16522330 ATGCCACTGTTAACAGAAGGAGG + Intergenic
1068210680 10:53915967-53915989 TGGATTCTGGTATCAGAAGGGGG - Intronic
1069815217 10:71189523-71189545 TAGCCTCTGTTAACAGTTCGGGG - Intergenic
1070571013 10:77638962-77638984 TGGCCTCTGACAGCAGCAGGTGG + Intergenic
1074834569 10:117276786-117276808 TGACGTCTGTAAACAGAAGTTGG + Intronic
1076532304 10:131153201-131153223 TGGCCTCTTCTAGCAGAGGGAGG + Intronic
1077192496 11:1261263-1261285 AGGCCACTGTGGACAGAAGGGGG + Intronic
1077674360 11:4183584-4183606 TGGCCTCTGTGAACTGCAGTGGG + Intergenic
1078203290 11:9204088-9204110 TGGTCTCTGTCATCAGCAGGGGG + Exonic
1080519545 11:33055642-33055664 GGGATTCTGTTAACAAAAGGAGG + Intronic
1084648979 11:70477167-70477189 TGACCGGTGTTAACAGAAGAGGG - Intronic
1089114600 11:116084329-116084351 TTGCCTTTGTGAAGAGAAGGTGG - Intergenic
1090064695 11:123492545-123492567 TGGCCTCTGTAACTAGAAGAAGG + Intergenic
1097844392 12:64351786-64351808 ACTCCTCTGTTAATAGAAGGAGG - Intronic
1098886526 12:75966279-75966301 TGGCCATTTTTAACAGAAAGAGG + Intergenic
1099012497 12:77308909-77308931 AGGCCTCTGTCAACCAAAGGTGG - Intergenic
1100406161 12:94274471-94274493 TGGCCTTTGTTAGCAGAGGAGGG + Intronic
1101405346 12:104423680-104423702 TGGTGTATGTCAACAGAAGGTGG - Intergenic
1101495900 12:105253952-105253974 TGGAGTCTGTTACCAGAAGAAGG + Intronic
1106571248 13:30930083-30930105 TGGCCTCTCATTCCAGAAGGAGG - Intergenic
1107178595 13:37429210-37429232 TGGCCTCAGTTATAAGAGGGTGG + Intergenic
1109611410 13:64769793-64769815 TGGCTTCTATTAACAGAAATGGG - Intergenic
1110006126 13:70272566-70272588 TGGCCTCATGTAACAGAAGGTGG + Intergenic
1110386017 13:74911829-74911851 TCCCCTCTCCTAACAGAAGGCGG + Intergenic
1111752230 13:92347152-92347174 TGGCATCTGTTCACAGAATATGG - Intronic
1112334618 13:98503911-98503933 TGGCTTCTGTCAACAGACGCTGG - Intronic
1114522010 14:23345678-23345700 TGGGCACTGTTAGCAGAAGCGGG - Intergenic
1116995501 14:51319499-51319521 TGACCTTTGTTAACAGGAGGTGG - Intergenic
1122124674 14:99572536-99572558 TGGACTCTGGTGACCGAAGGGGG - Intronic
1122987981 14:105221379-105221401 TGGCCCCTGTGACCTGAAGGCGG + Intronic
1124627730 15:31318597-31318619 TGGGCTCTGTGAGCAGAAGCAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128128744 15:65211595-65211617 TGGCCTCTGTGAACTGCAAGGGG - Intergenic
1135495965 16:22951376-22951398 TGGTCTCTATTAGGAGAAGGAGG - Intergenic
1135962069 16:27003331-27003353 TGGCCTCTGTTGACACCTGGTGG - Intergenic
1136018964 16:27427782-27427804 TGGCCTCTGATCGCAGGAGGGGG - Intronic
1140192511 16:72829969-72829991 GGGCCTCTGGAAAGAGAAGGGGG - Intronic
1140612817 16:76621598-76621620 GGGCCTCTATTAACTTAAGGAGG - Intronic
1143057417 17:4172675-4172697 TGGCCTCTGATAAAACAAGTTGG + Exonic
1145118594 17:20235063-20235085 TTGCCTCTGTTAAAAGAGGTGGG + Intronic
1145964987 17:28910708-28910730 TGATCTCTGTGAACACAAGGTGG - Intronic
1149849981 17:60028487-60028509 TGACCTCTGTCCACAGAAGGGGG - Intergenic
1149860186 17:60118037-60118059 TGACCTCTGTCCACAGAAGGGGG + Intergenic
1149863141 17:60135418-60135440 TGGACTCTGTTAACAGAGTCTGG + Intergenic
1150487594 17:65554708-65554730 TGGCCTCCCTTAAAAGAAGTCGG - Intronic
1150988363 17:70226010-70226032 TTCCTTCTGTTAACAGAAGAGGG - Intergenic
1151082169 17:71341722-71341744 TGCTCTCTGTTACCAGAAAGGGG - Intergenic
1151572717 17:74935326-74935348 TGGACCCTGTCAGCAGAAGGAGG + Intergenic
1151591710 17:75048580-75048602 TGGCTTCTATTACCACAAGGAGG - Intronic
1151920858 17:77154423-77154445 TGGCCTGTGTGAACAGAGCGAGG + Intronic
1154152103 18:11914421-11914443 TGGACCCTGTTAACAGATGCAGG + Intergenic
1154400609 18:14033360-14033382 TGGCCTGTGCTGGCAGAAGGGGG + Intergenic
1155032792 18:21998796-21998818 TGGACACTGTTGGCAGAAGGTGG + Intergenic
1155176650 18:23307061-23307083 TGGACTCTGTTCACTGTAGGAGG - Intronic
1160352998 18:78201082-78201104 TGGCCACTGTAAACAGGAGAGGG - Intergenic
1160443712 18:78911933-78911955 TGGCCTGAGGTGACAGAAGGAGG - Intergenic
1161907677 19:7169235-7169257 TGACCTCTGTGAACAGAGAGCGG - Intronic
1166228464 19:41411719-41411741 AGACCTCTGTTAACAGAGGAGGG + Intronic
1166504805 19:43364528-43364550 TGGCATCTGATTACAGAGGGAGG - Intergenic
1166505735 19:43370386-43370408 TGGCATCTGATTACAGAGGGAGG + Intergenic
926039046 2:9658030-9658052 TACCCTCTGTGAGCAGAAGGTGG - Intergenic
927304309 2:21553120-21553142 TGGCTTCTGTTCTCAGCAGGAGG + Intergenic
929898512 2:45982155-45982177 TGGCCTCTGGAAGCACAAGGTGG - Intronic
929914672 2:46124585-46124607 TGGTCATTTTTAACAGAAGGAGG - Intronic
931673069 2:64666344-64666366 TTACCTCTGGTAACAGGAGGAGG + Intronic
935534271 2:104274602-104274624 TTGCCTATGTTTACAGGAGGTGG - Intergenic
939024430 2:136995195-136995217 TGGGGTCTGTGACCAGAAGGTGG + Intronic
939507067 2:143058289-143058311 TGGCTTATGTTAAAGGAAGGAGG - Intergenic
941374840 2:164714699-164714721 TGGCCTCTGTTAACACATGCTGG + Intronic
942645044 2:178101523-178101545 TGACCTCTGGGAACAGAAAGGGG - Intronic
942713823 2:178868518-178868540 TGGTCTCTATTAACATAAGATGG - Intronic
947113204 2:226742373-226742395 TGGCCTGTTTTAAAAGAAGTTGG - Intronic
1172055210 20:32150035-32150057 TGGCCTCTGACTACAAAAGGAGG - Intronic
1173721168 20:45259305-45259327 TGGCATCTGCTATCAGAATGGGG - Intergenic
1176043443 20:63080293-63080315 GGGCCTCTGCAAACAGATGGGGG - Intergenic
1176375154 21:6083357-6083379 GGGCCTTTGGGAACAGAAGGTGG + Intergenic
1178044047 21:28674438-28674460 GGGCTGCTGTTACCAGAAGGGGG - Intergenic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1179614125 21:42570798-42570820 TGGCCTCTGTTCACAGACGCAGG - Intronic
1179748320 21:43454887-43454909 GGGCCTTTGGGAACAGAAGGTGG - Intergenic
1184841281 22:47053613-47053635 AGGCCTCTGTGCACAGCAGGAGG + Intronic
949415201 3:3806443-3806465 TAGCCTCTTTGAACATAAGGGGG + Intronic
950560567 3:13719188-13719210 TACCTTCTGTTTACAGAAGGTGG - Intergenic
951682323 3:25307705-25307727 TGGCCTCTGTCACTAGAATGAGG + Intronic
953396210 3:42572573-42572595 TGGCCTCTGTTAACACCCTGGGG - Intronic
955783894 3:62515698-62515720 TTTCCTCTGTTTAAAGAAGGGGG + Intronic
961404313 3:126667762-126667784 TGGCCTTGGTTAACACAAAGAGG - Intergenic
966260674 3:177974918-177974940 TGACCTCTGTTAAACTAAGGTGG - Intergenic
969883678 4:10196634-10196656 AGCCCTCTGTCAGCAGAAGGTGG + Intergenic
971534332 4:27729900-27729922 TGCCCATTGTTAACAGAAGCAGG + Intergenic
972969662 4:44557673-44557695 TTGCCTCTGTAAAAAGAAGTGGG - Intergenic
973291920 4:48479747-48479769 TGGGTGCTGTTAACAGAAAGAGG - Intergenic
977627241 4:99200648-99200670 TGGGCTGTTTTAACAGAAGTAGG + Intergenic
980347726 4:131644163-131644185 TGGCCTCAAATAACAGAATGTGG - Intergenic
982562421 4:156946267-156946289 TGGACTATGTTATCAGAATGAGG + Intronic
983941243 4:173536662-173536684 TGGCCTGTGTTAACTTAAGTGGG - Intergenic
983995277 4:174175037-174175059 TGGACACTGTTACCAGAAAGCGG + Intergenic
984963312 4:185119267-185119289 TTGACCCTTTTAACAGAAGGCGG - Intergenic
985695027 5:1335321-1335343 AGGCCTGTGGTGACAGAAGGAGG - Intronic
986379325 5:7167009-7167031 TGGCTTATGGTAACAGAAGACGG + Intergenic
989157770 5:38360607-38360629 TGGCCTCAGACAACAGAATGGGG + Intronic
990263754 5:54053954-54053976 TTTCCTCTGTTAAGAGTAGGGGG - Intronic
994254181 5:97573211-97573233 TTGCCTGTGTGAACATAAGGAGG - Intergenic
996803573 5:127429880-127429902 TGGTCCCTGTTAACACCAGGGGG + Intronic
997758559 5:136423114-136423136 TGGCATCTGCTGACAGAAGAAGG + Intergenic
1000680090 5:164172690-164172712 TGGCCTCTTCTAACAGCAGATGG - Intergenic
1000912349 5:167037688-167037710 TTGCCTCTGTTATAGGAAGGAGG - Intergenic
1004426571 6:15510895-15510917 TGGCCTCTGTTAACAGAAGGAGG + Intronic
1004729514 6:18344100-18344122 TTGCCTCAGATAACAGCAGGGGG + Intergenic
1004736936 6:18416219-18416241 CTGCCTTTCTTAACAGAAGGAGG - Intronic
1008113565 6:47520497-47520519 TGGCCTCCGCTGACAGCAGGGGG + Intronic
1008641021 6:53462932-53462954 AGGGCTCTGTGATCAGAAGGAGG - Intergenic
1013455012 6:110322702-110322724 TTGCCTCTTTTGAAAGAAGGAGG - Intronic
1015734853 6:136388193-136388215 TGGCCTGTGTTAAGGGAAAGAGG + Intronic
1017490094 6:154937414-154937436 CGGCCACTGTCATCAGAAGGGGG - Intronic
1018542127 6:164893440-164893462 TTGCCTGTGTTTACAGCAGGTGG - Intergenic
1019093740 6:169562532-169562554 GGGCTTCTGAGAACAGAAGGGGG + Intronic
1023950252 7:44838361-44838383 TGGCCTCTTTTAATAAAAGGTGG + Intronic
1024274890 7:47669519-47669541 TGGCCCCTGTTGAAAGAAAGTGG + Intergenic
1028492085 7:91423813-91423835 TGGCCTGTGATATGAGAAGGTGG - Intergenic
1030989767 7:116286415-116286437 TAGCCTCAGTTTACAGAAAGTGG - Intergenic
1033645563 7:143300402-143300424 TGGCAGCAGTGAACAGAAGGAGG - Intronic
1034419283 7:150980442-150980464 TTGCCTCTGTGCACAGAAGGAGG - Intergenic
1035382127 7:158446864-158446886 TGGCTTCTGTGGACTGAAGGCGG + Intronic
1036721173 8:11176930-11176952 TGGCCAATGCTAAGAGAAGGTGG + Intronic
1039970425 8:42317267-42317289 TGGCCTCTGTGTACAGAACTGGG + Intronic
1041029626 8:53723691-53723713 TGGGGACTGTGAACAGAAGGAGG - Intronic
1041611104 8:59850905-59850927 AGGCCTCTGTTGACAGTTGGAGG + Intergenic
1043705630 8:83346034-83346056 TGGCCACTGTTAAATGAATGGGG - Intergenic
1047759425 8:127943128-127943150 TGTCCTCTGGGGACAGAAGGAGG + Intergenic
1048571315 8:135659433-135659455 TGGCCTCTGTTGACAAGGGGAGG + Intergenic
1060472923 9:123963567-123963589 TGTCATCTGTTAAAAGAAAGGGG - Intergenic
1061935362 9:133854618-133854640 TGGCCGCTGTGACCAGAAGCAGG + Intronic
1185719602 X:2371416-2371438 GGGTCTGTGGTAACAGAAGGAGG - Intronic
1186673788 X:11794414-11794436 TGGCCTCAGTTAGCACAACGAGG + Intergenic
1186865534 X:13717352-13717374 TGGCTTAAGTGAACAGAAGGTGG + Intronic
1187035603 X:15536372-15536394 TGGCCTTTGTTGACACAGGGTGG - Exonic
1190232650 X:48594316-48594338 AGGGCTCTGTTGAGAGAAGGTGG + Intronic
1195915050 X:109927771-109927793 TAGCCTCTGGTAACTGCAGGAGG - Intergenic
1198797452 X:140414088-140414110 TGGCCTCTAAGAACTGAAGGTGG - Intergenic