ID: 1004426836

View in Genome Browser
Species Human (GRCh38)
Location 6:15512424-15512446
Sequence CACGGCACTCACAGGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004426836 Original CRISPR CACGGCACTCACAGGGATGC GGG (reversed) Intronic
900174740 1:1286691-1286713 GACAGCACACACTGGGATGCTGG + Intronic
902225149 1:14992075-14992097 CAGGGCACTCACTGTCATGCTGG - Intronic
902801366 1:18832136-18832158 CACTGCCCTCCCAGGGCTGCTGG - Intergenic
911019001 1:93367541-93367563 CACGGCACACACACGCATACTGG + Exonic
915989401 1:160498433-160498455 CATGGCACTCACAAGCATGGTGG + Intronic
916495617 1:165344290-165344312 CACCGTCTTCACAGGGATGCAGG - Intronic
918787240 1:188777515-188777537 AACGCCACACTCAGGGATGCGGG - Intergenic
919674023 1:200363538-200363560 CACTCCACTCACAGGGAAGTCGG - Intergenic
919829555 1:201530994-201531016 CACGGCACTGTCAGAGATACTGG + Intergenic
919846897 1:201648249-201648271 CACGGGACTGACAGGCAGGCAGG + Exonic
919941437 1:202289271-202289293 CAAGGCACTCACTGACATGCTGG - Intronic
920021159 1:202957897-202957919 CGCAGCACTCACAGGACTGCCGG + Intronic
1062788678 10:286785-286807 CATGGCACACACATGGATGGAGG + Intronic
1062994503 10:1853337-1853359 GACGGCACTCACAGGGCTCACGG - Intergenic
1063443943 10:6096293-6096315 CACTGCACAGACATGGATGCTGG - Intronic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1068474329 10:57506697-57506719 CTCCGCACTCTCAGGGATCCAGG + Intergenic
1070595359 10:77829249-77829271 CACCTCATTCACAGGGATGAGGG - Intronic
1070765721 10:79054990-79055012 CAGGGCACTCACTGGAATGAGGG + Intergenic
1073119863 10:101115022-101115044 CAGGTCACTCTCAGGGATTCAGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1076279494 10:129233658-129233680 CATGGCCCTCCCAGAGATGCTGG - Intergenic
1076767500 10:132644553-132644575 CACGGCACTCACTGTGAGCCAGG - Intronic
1077301677 11:1850153-1850175 CACGGCAGCCACAGGGCAGCAGG - Intergenic
1077351023 11:2093245-2093267 GGCGGCTCTCACAGGGAGGCTGG - Intergenic
1082833743 11:57638110-57638132 CACGCCCCGCACAGGGCTGCAGG - Intergenic
1085026344 11:73238804-73238826 CACGACACTCACAGCCCTGCAGG + Intergenic
1085314436 11:75535831-75535853 CCCGTCAGTCACAGAGATGCAGG + Intergenic
1085958464 11:81430077-81430099 TAAGGCACTCTCAGGGCTGCAGG - Intergenic
1087958740 11:104322135-104322157 CACGGCTCTCACTAGGATGTAGG + Intergenic
1095978894 12:47959103-47959125 CAGGGCAGCCACAGGGCTGCTGG - Intergenic
1099300749 12:80891603-80891625 CACGGAACTCACAGGCTTGAGGG + Intronic
1103524379 12:121558092-121558114 CACGGCACTCACAGAGCAGCAGG - Intronic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1112326658 13:98446314-98446336 CACGGGGATGACAGGGATGCTGG + Intronic
1113771691 13:112913709-112913731 CACGGCTGCCCCAGGGATGCTGG + Intronic
1114719816 14:24869339-24869361 CACAGAAGTCACAGAGATGCTGG - Intronic
1115779637 14:36755439-36755461 CAGGGCACTGACAGGGATGAAGG - Intronic
1117472354 14:56058880-56058902 CACATCACTCACAGACATGCTGG + Intergenic
1119320228 14:73726133-73726155 CAGGGCACTGACAGGGGTGTCGG + Intronic
1121464165 14:94103514-94103536 CAGGGCTCTCCCTGGGATGCTGG + Intronic
1121937064 14:98029705-98029727 CACTGATCTCTCAGGGATGCTGG - Intergenic
1122412438 14:101532648-101532670 CCTGGCTCTCATAGGGATGCTGG - Intergenic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1122836517 14:104433449-104433471 CACGGCATCCACAGGGCTCCTGG + Intergenic
1127910319 15:63411124-63411146 CACGGCACTGACAGGCCTTCTGG + Intergenic
1129167529 15:73787238-73787260 CACTGGACTCACAGGGCTGGTGG + Intergenic
1129262659 15:74377373-74377395 CAGGGCTCTCACAGGGGTGTAGG - Intergenic
1136050430 16:27646345-27646367 CACGGCTCTAACAGGAATCCAGG + Intronic
1136469840 16:30472848-30472870 CATGGCCATCACAGTGATGCAGG - Exonic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1142727269 17:1824977-1824999 CACAGCCCTCACAGGGTGGCAGG - Intronic
1143138050 17:4723113-4723135 CACGGGAGTCGGAGGGATGCTGG - Intergenic
1148676118 17:49445962-49445984 CACAGCACCCACAGTGCTGCGGG + Intronic
1148784017 17:50136418-50136440 CACCCCACTCGCAGGGAGGCTGG + Intronic
1150180290 17:63112156-63112178 CACAGCACTAAAAGGAATGCTGG - Intronic
1152565009 17:81096467-81096489 CAGGGAACTGCCAGGGATGCTGG - Intronic
1154095744 18:11413588-11413610 CACTGCACTCACAGGGAGACAGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156383351 18:36583655-36583677 CATGGCACTCACAAAGAAGCTGG - Intronic
1156869628 18:41930697-41930719 CATGGCACACATAGGGCTGCTGG + Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157636609 18:49162815-49162837 CACTGCACTCACAAGGTTGGAGG + Intronic
1160104918 18:75964932-75964954 CCTGGCAGTCACGGGGATGCTGG + Intergenic
1160386805 18:78501891-78501913 CTCGCCTCTCACAGGGCTGCTGG - Intergenic
1161656565 19:5519369-5519391 CCGGGCACTAACAGGGCTGCTGG + Intergenic
1163777518 19:19226988-19227010 CATGGCAGTCACAGAGATGTTGG + Exonic
1166442443 19:42826656-42826678 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166450007 19:42890686-42890708 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166461885 19:42994973-42994995 CACAGCTCTCCCTGGGATGCTGG - Intronic
1166479165 19:43154935-43154957 CACAGCTCTCCCTGGGATGCTGG - Intronic
1167713487 19:51126036-51126058 CCCAGCCCTCACAGTGATGCGGG + Intronic
1167716365 19:51144867-51144889 CCCAGCCCTCACAGTGATGCAGG + Intronic
925348270 2:3184977-3184999 CACCCCACGCACAGGGATGCAGG + Intergenic
926653033 2:15367367-15367389 CACAGCACTGCCAGGGAGGCTGG + Intronic
932566694 2:72915611-72915633 CAAGGTTCCCACAGGGATGCGGG - Intergenic
944540046 2:200746023-200746045 CACAGCACTCAGAGGGAACCAGG - Intergenic
948050642 2:234977022-234977044 TAAGACACTCACAGGGAAGCCGG + Intronic
948496228 2:238351538-238351560 CACGGCAGGCACAGGGGCGCAGG + Intronic
1169499739 20:6147973-6147995 CACTGCCCTGACAGGGATCCTGG + Intergenic
1170029367 20:11929182-11929204 CCCGGCAGTCACAGAGATGCCGG + Intergenic
1171303989 20:24089168-24089190 CACGGCATTAACAGGGCTCCTGG - Intergenic
1172094002 20:32451901-32451923 CTCGGCACCCACAGGGACCCTGG + Intronic
1174592486 20:51657465-51657487 CACTGCACTGAAAGGGATCCCGG + Intronic
1175925557 20:62469629-62469651 CCTGGCACTCGCAGGGGTGCGGG - Intronic
1178536477 21:33414226-33414248 CATCGCAATCACAGGGGTGCTGG - Intronic
1178958639 21:37044492-37044514 CAGGGCCCTCACAGGGAATCTGG + Intergenic
1179476582 21:41650396-41650418 CTCCGCACTCACAGGGCTACTGG + Intergenic
1180825433 22:18857919-18857941 CAGGGCCCTCCCAGGGATGCTGG + Intronic
1181187298 22:21116628-21116650 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181211900 22:21293865-21293887 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181277312 22:21695060-21695082 CGCGGCACTCACGTGGCTGCTGG - Exonic
1181397598 22:22633021-22633043 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181500346 22:23312391-23312413 CAGGGCCCTCCCAGGGATGCTGG - Intronic
1181651808 22:24263037-24263059 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181705568 22:24647702-24647724 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1182629791 22:31676430-31676452 CACTGCAAACACAGGGATGGGGG - Intronic
1183964228 22:41431772-41431794 CAGCCCACACACAGGGATGCAGG + Intergenic
1203275580 22_KI270734v1_random:83822-83844 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952212317 3:31240567-31240589 CATGAAACTGACAGGGATGCAGG + Intergenic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
961397937 3:126610054-126610076 CAGGGCAGTGACAGGGATGGCGG - Intronic
963351072 3:144151723-144151745 CCCTGCACTCACAGGCAGGCAGG - Intergenic
964118744 3:153161773-153161795 CACGGCACCCACAGGACTTCGGG + Intergenic
968045769 3:195623269-195623291 GGCGGCACTCACAGGTTTGCGGG + Intergenic
968308887 3:197666818-197666840 GGCGGCACTCACAGGTTTGCGGG - Intergenic
968876436 4:3270220-3270242 CACGGCTCCCACATGGAGGCTGG - Intronic
968935726 4:3609179-3609201 CACGGCACTGACAGGGAAGAGGG + Intergenic
969391563 4:6894797-6894819 CACGCCCCTCCCAGGGTTGCCGG + Intergenic
973039769 4:45456180-45456202 CACTGCACTCACAGGCATTTAGG - Intergenic
974237087 4:59195948-59195970 CAAAGCACTCACAGTTATGCAGG + Intergenic
985747520 5:1655573-1655595 GGCGGCACTCACAGGTTTGCGGG - Intergenic
985850515 5:2385253-2385275 CACTGAACTCAGAGGGATGGAGG - Intergenic
986602734 5:9489461-9489483 CAGGGCACCCACAGGGATGGCGG + Intronic
997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG + Intergenic
998447846 5:142212083-142212105 CTGGCCACTCACAGGGATCCTGG - Intergenic
1001953100 5:175829868-175829890 CACAGAATTCACAAGGATGCGGG + Intronic
1004426836 6:15512424-15512446 CACGGCACTCACAGGGATGCGGG - Intronic
1005406801 6:25498033-25498055 CACTGCACTCTGAGTGATGCTGG - Intronic
1007420992 6:41719600-41719622 CACGGCAGTTACTGGCATGCAGG + Intronic
1007812789 6:44498117-44498139 GTCGGCACTTACAGGCATGCTGG + Intergenic
1009294120 6:61922581-61922603 CACTGCACTCACAGGGAACCAGG + Intronic
1011030517 6:82917801-82917823 CACAGAACTCTCAGGGCTGCTGG + Intronic
1011741935 6:90370505-90370527 CACTGCACTCACAGGGGTGTGGG - Intergenic
1014202959 6:118624937-118624959 CACCACATTCACAGGAATGCAGG + Intronic
1015166811 6:130207927-130207949 CTCTGCACTCATAGGGCTGCTGG + Intronic
1019168841 6:170117325-170117347 CACGGCCCTCGGAGGGAGGCTGG - Intergenic
1022835875 7:34114198-34114220 CTCGGCCCCCACAGGGATGGAGG - Intronic
1024637588 7:51302998-51303020 TACCCCACTCACAGGGCTGCCGG + Intronic
1036644247 8:10602029-10602051 CTCCTCACTCACAGGGCTGCAGG + Intergenic
1041821126 8:62033975-62033997 GACAGCACTCATAGGGATGAGGG - Intergenic
1043960889 8:86417089-86417111 AAGGGCACACACAGGGATTCAGG + Intronic
1046362486 8:113180893-113180915 CACAGACCTCACTGGGATGCTGG + Intronic
1050562920 9:6852981-6853003 CAAGGCACACACAGGCAAGCTGG - Intronic
1053156774 9:35786511-35786533 CTGGGCACTCACAGAGGTGCTGG + Intergenic
1055767694 9:79682522-79682544 CAGGCCCCTCACAGGAATGCAGG - Intronic
1057432053 9:95004366-95004388 CACGGCAGTCTGAGGGCTGCGGG + Intronic
1057566409 9:96169436-96169458 CCCGGCACTGCCAGGGGTGCCGG - Intergenic
1059431283 9:114251890-114251912 CAAGGCACTCAGAGGGTTGTAGG - Intronic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1062044875 9:134420336-134420358 CCCAGCACTCACAGGGCTCCCGG - Intronic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1192538352 X:71947685-71947707 CACAGAGCTCACAGGGAAGCAGG - Intergenic