ID: 1004427600

View in Genome Browser
Species Human (GRCh38)
Location 6:15516951-15516973
Sequence CTGACCAAACACCTGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004427600_1004427606 30 Left 1004427600 6:15516951-15516973 CCATGTTCCAGGTGTTTGGTCAG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1004427606 6:15517004-15517026 AGTCCTCAAAGCCCTTGGCCCGG 0: 1
1: 0
2: 4
3: 19
4: 160
1004427600_1004427604 25 Left 1004427600 6:15516951-15516973 CCATGTTCCAGGTGTTTGGTCAG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1004427604 6:15516999-15517021 TTTCCAGTCCTCAAAGCCCTTGG 0: 1
1: 0
2: 0
3: 25
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004427600 Original CRISPR CTGACCAAACACCTGGAACA TGG (reversed) Intronic
900099980 1:958010-958032 CTGAATAAAGACCTCGAACAAGG - Intronic
900618131 1:3574487-3574509 CTGACCACTCACCTGGACCCAGG + Intronic
902089778 1:13893712-13893734 CTGACCAAAGACGTGGGAGAAGG - Intergenic
902651046 1:17837822-17837844 CTGACAAAGCACTTGGAACTTGG - Intergenic
903743665 1:25572899-25572921 CTGGCCAGACACCTAGAAGAGGG + Intergenic
903751260 1:25622380-25622402 CTGCCCAAGCACCTAGAATAGGG + Intronic
904049319 1:27629004-27629026 CTGACAAAACAGCATGAACATGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
908348678 1:63262478-63262500 CTGACCACACACCTTTCACAGGG + Intergenic
909079485 1:71091845-71091867 CTACCCAAGCACCTGGAACAAGG + Intergenic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
914195183 1:145444634-145444656 CTGACAAGACACATGTAACAGGG + Intergenic
914476454 1:148027210-148027232 CTGACAAGACACATGTAACAGGG + Intergenic
919469148 1:197957411-197957433 CTGAGTAAAGACCTGGAAGAGGG + Intergenic
919625719 1:199908181-199908203 CCATCCAAACTCCTGGAACAAGG - Intergenic
920624430 1:207582813-207582835 CTGGCCAAAAACCTGGAAACTGG - Intronic
920953632 1:210597767-210597789 CTGAGCCAAAACCTGGAACTGGG + Intronic
921030034 1:211328402-211328424 CTGAGCCAGCATCTGGAACATGG + Intronic
921215560 1:212933987-212934009 CTGTCCAAACACTTGCCACATGG - Intergenic
923525380 1:234768624-234768646 CTGAGCACTCACCTTGAACAGGG + Intergenic
923734906 1:236596965-236596987 CTCAGCAAAAACCTGAAACAAGG + Exonic
1067771618 10:49130736-49130758 CTGATCAAACAGCTTGAACTTGG + Intergenic
1070010513 10:72469528-72469550 CTGATAAAACATCTGGAAAATGG - Intronic
1070975614 10:80603696-80603718 CTGGCCAAGCTCCCGGAACATGG - Exonic
1073547349 10:104362119-104362141 CTGACCAAACTAGTGGAGCAGGG + Exonic
1074035430 10:109733656-109733678 CTGACCACCCACCTGGGCCAGGG + Intergenic
1074853722 10:117458190-117458212 CTTTCCAAACTCCTGGATCAGGG - Intergenic
1076147992 10:128140291-128140313 CTGACCAAACACTTCGAAATTGG + Intergenic
1076595377 10:131621973-131621995 CTGACCATACACCTGCCCCAGGG + Intergenic
1076989804 11:267165-267187 CTTCCCAAGCACCTAGAACAGGG - Intergenic
1078312932 11:10264499-10264521 CTGGCAAAATACCTGGCACATGG - Intronic
1078706200 11:13746568-13746590 CTGACCAAGAACCTGACACAGGG - Intergenic
1083798509 11:65032534-65032556 CTCACCAAACACCTGGGCCCGGG - Exonic
1084911826 11:72395751-72395773 CTGACCAACCACATGGAAGTCGG - Intronic
1086596126 11:88573422-88573444 CTGAAGAGACACTTGGAACAGGG - Intronic
1088142582 11:106635149-106635171 ATGTCCCAACACCTAGAACAAGG + Intergenic
1088910054 11:114183939-114183961 CAGGCCAAGCACCTGGTACACGG - Intronic
1089985201 11:122805900-122805922 CAGACCATACACTTGGCACAAGG - Intronic
1093756489 12:22858892-22858914 CTGAGCAGAAACCTGGAAAAAGG + Intergenic
1094383197 12:29866151-29866173 CTGCCCCAATACCTAGAACAGGG - Intergenic
1096005345 12:48166041-48166063 CTGAGCATAGACCTGGAAGATGG + Intronic
1097124914 12:56766381-56766403 GAGAGCAAAGACCTGGAACATGG - Intronic
1097395056 12:59063254-59063276 CTGATCACACACTTGGAAAAAGG - Intergenic
1102202429 12:111066923-111066945 TTGGCCAAGCACCTGGTACATGG + Intronic
1103150615 12:118635508-118635530 CAGCACAAACACCTGGCACATGG - Intergenic
1103331353 12:120156449-120156471 CTGAGCACACACCCGGAGCACGG + Exonic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1107391272 13:39966979-39967001 TTGACCAGACACCCAGAACATGG - Intergenic
1114974778 14:28081928-28081950 CAAACCAAATACCTGGAAAATGG + Intergenic
1117656568 14:57961958-57961980 ATTACCCAACACCTGGAGCAGGG + Intronic
1118321847 14:64757955-64757977 CTGACCCAACACCTGGGAAGGGG - Intronic
1118768827 14:68928323-68928345 CTGGACAAAGCCCTGGAACATGG + Intronic
1119739452 14:77004816-77004838 CTGAGCAGACACCTGGACTATGG - Intergenic
1122651522 14:103229457-103229479 GTGACCAGACCCCAGGAACAGGG + Intergenic
1127877291 15:63122166-63122188 CTGGCGAAGCACCTGGAGCAGGG - Exonic
1128781519 15:70361876-70361898 CTGACCAACCACGTGGTACTGGG - Intergenic
1130260955 15:82353936-82353958 GTGACCAAACACCTGAGAAAGGG - Intergenic
1130280280 15:82515080-82515102 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130471653 15:84231263-84231285 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130479147 15:84345834-84345856 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130492623 15:84442296-84442318 GTGACCAAACACCTGAGAAAGGG - Intergenic
1130593948 15:85235894-85235916 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130613105 15:85379347-85379369 GTGACCAAACACCTGAGAAAGGG - Intergenic
1134021838 16:10926424-10926446 CAGACCAAAAACCTGGCACATGG - Exonic
1138914119 16:61442119-61442141 CTGCCCAAACCCCTGGCAAACGG - Intergenic
1140222659 16:73055362-73055384 CAGACCAAACACCTGAAAGGGGG + Intronic
1141208318 16:81952957-81952979 GTTACCAACCACCTGGAATAAGG + Intronic
1141675398 16:85514753-85514775 CTGACCAACCCCCTGGGGCAAGG - Intergenic
1144785928 17:17831544-17831566 CTGGCCAAGAGCCTGGAACAGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149101043 17:52907696-52907718 GTCACCAAAAACCTGGAAAAAGG - Intergenic
1151786192 17:76276176-76276198 CTCACCCCACACCTGGCACAGGG - Intronic
1156118184 18:33812445-33812467 CTGACTCACCACCTGGAGCATGG + Intergenic
1159604958 18:70465787-70465809 CTGACTGGAGACCTGGAACAAGG + Intergenic
1160243017 18:77136505-77136527 CTGACCCCACCCCTGCAACAGGG - Intergenic
1160329023 18:77975539-77975561 CCCACCAAACACCTGGTTCAGGG + Intergenic
1160818675 19:1047871-1047893 CTGGCCATACACCTGGAATCAGG - Intronic
1164100439 19:22050246-22050268 TAGACCAAACACCTAGAAGATGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
933112150 2:78416441-78416463 CTGAGCTCACACATGGAACAGGG + Intergenic
936161126 2:110084899-110084921 CTGAACAAGTACCAGGAACAAGG + Exonic
936183537 2:110286455-110286477 CTGAACAAGTACCAGGAACAAGG - Intergenic
936351137 2:111713423-111713445 CTCACCAAACACTTGCCACAAGG + Intergenic
942313695 2:174680069-174680091 CAGACCAAATACAGGGAACAGGG - Intronic
947150861 2:227113890-227113912 ATGACCACACATCTTGAACATGG + Intronic
948432241 2:237927126-237927148 CTCACCAAACTGATGGAACAGGG - Intergenic
948799746 2:240427046-240427068 GTGACCAAACACCTCCCACAGGG + Intergenic
1169092247 20:2868122-2868144 CTGCCAGAACACCTGCAACATGG + Intronic
1170321147 20:15099395-15099417 CTCTCCACACACCTGCAACAAGG + Intronic
1170365504 20:15593923-15593945 CTCACCAAAGACCTTGTACATGG - Intronic
1171240308 20:23562600-23562622 CTGCCCAACCACATGGAAAAAGG - Intergenic
1172091937 20:32439139-32439161 TTTACCAAAGACCGGGAACAGGG + Exonic
1172274395 20:33671849-33671871 GTGACCAACCATCTGGACCAGGG - Intronic
1172502036 20:35434374-35434396 GCGGCCAAACACCAGGAACAGGG + Exonic
1172668023 20:36614155-36614177 CTGACTCAACTCCTGGAGCACGG - Intronic
1173376564 20:42489244-42489266 CTGACCATGTGCCTGGAACAAGG - Intronic
1175698279 20:61118796-61118818 CTGCCTACACACCTGCAACAAGG + Intergenic
1175751295 20:61499735-61499757 CTGAGCAGACACCAGGAACAGGG + Intronic
1176105966 20:63386879-63386901 TTGAGAAAACACCTGGCACACGG + Intergenic
1177098184 21:16865716-16865738 CTGGCCAAACATCAGGAACAAGG - Intergenic
1179443138 21:41410024-41410046 ATGACCAAAAACTTGGAAAAAGG + Intergenic
1180235174 21:46454666-46454688 GTGGCCAAACACCAGGAAGAAGG - Intergenic
1182137213 22:27917928-27917950 CTGAGCAAAGACCTGGAAGAAGG + Intronic
1184038906 22:41932093-41932115 CTGACCCCATTCCTGGAACACGG - Intergenic
1184259468 22:43306328-43306350 CTGACCAAGCTCTTGGCACAGGG + Intronic
1184784448 22:46664929-46664951 CTTACCACTCACCTGGGACATGG + Intronic
950458079 3:13104532-13104554 CTGACCCAGCACTCGGAACAGGG + Intergenic
951295309 3:20926429-20926451 ATGACCAAACACCTCCAACTAGG + Intergenic
953545378 3:43860474-43860496 CTCACCAGACACCAGGACCATGG - Intergenic
953981343 3:47414641-47414663 CAGACGGAACACCTGGGACAGGG + Exonic
959039406 3:101403699-101403721 CTGATAAAACAACTTGAACAAGG + Intronic
960830912 3:121846874-121846896 ATAACCAAACACCTGGAAGATGG - Intronic
961107174 3:124251891-124251913 CATTGCAAACACCTGGAACAGGG - Intronic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
969963057 4:10965539-10965561 CTGACCAATCGCCTGTCACAAGG + Intergenic
970322636 4:14890198-14890220 CTCAGCAAACACTTGGCACATGG - Intergenic
972660146 4:41108646-41108668 CTGACCAAACACCCTGCCCAGGG + Intronic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
977681110 4:99799397-99799419 CTGACCAAACAGCTTGCTCAAGG + Intergenic
978370014 4:108020528-108020550 CTGACCATAAACCTGGAAGGTGG + Intronic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
979569223 4:122197620-122197642 CTGCCCAAACGTCTGGTACAGGG - Intronic
981395429 4:144242508-144242530 TTTCCCAAAGACCTGGAACAAGG - Intergenic
981409065 4:144406210-144406232 CTGACAAAACAATTGTAACAAGG - Intergenic
983630884 4:169848213-169848235 CAGAGCAAACAACGGGAACAGGG - Intergenic
985677443 5:1239311-1239333 CTGTACAGACACCAGGAACAGGG - Intronic
985953793 5:3244728-3244750 ATGACCAAACACCTTTCACAAGG + Intergenic
988563851 5:32304751-32304773 CTGATCAAACAGCTGCCACATGG - Intronic
989630546 5:43477668-43477690 CTGACCAAACTCCTGTCACCAGG + Intronic
995827715 5:116319374-116319396 CTGACCTGAAAACTGGAACATGG + Intronic
995909829 5:117173113-117173135 CTGAGCAAACCCCTGAAAAATGG - Intergenic
997677332 5:135722814-135722836 CTGACCGGACACCAGGGACAAGG - Intergenic
997894419 5:137703475-137703497 CAGACCACTCACCTGCAACAGGG - Intronic
999796547 5:154994318-154994340 GTGACCATCCACCTGAAACAAGG + Intergenic
1000703546 5:164482895-164482917 CTTATTAAACACCTGGAACAGGG - Intergenic
1001962753 5:175890053-175890075 ATGAGCAAACACTTGGAACCTGG + Intergenic
1002553112 5:180012360-180012382 GGGACCTAACACCTGGAACCTGG + Intronic
1003281718 6:4698354-4698376 GTGACCAAAAAGCTGAAACAGGG + Intergenic
1004427600 6:15516951-15516973 CTGACCAAACACCTGGAACATGG - Intronic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006450800 6:34104710-34104732 GTGGGGAAACACCTGGAACAGGG - Intronic
1006985105 6:38170662-38170684 CTGAGCAAACACCAGGCACTAGG + Exonic
1010554284 6:77259678-77259700 CTGACCAAGCATCTTGAACTTGG - Intergenic
1010941678 6:81926449-81926471 TTTACAAAATACCTGGAACAGGG + Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1014006022 6:116419050-116419072 CTGATCAAACACTTGGAATATGG + Intronic
1017761850 6:157575321-157575343 TTGACCGAACAACTGGCACATGG + Intronic
1018503323 6:164437133-164437155 CTGACTAATCAGCAGGAACAGGG - Intergenic
1019732649 7:2636468-2636490 CTGGACAAGCATCTGGAACACGG - Intronic
1019746482 7:2703008-2703030 CTTCCCAAACACCTGGGAAATGG - Intronic
1019934711 7:4246721-4246743 CTCACCAAGCAGCTGGACCAGGG + Intronic
1022411860 7:30145110-30145132 ATGTTCAAAGACCTGGAACAAGG - Intronic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1023431318 7:40094343-40094365 CTGAGCAAGCAGCTGTAACAGGG - Exonic
1023784754 7:43694847-43694869 CTGAGCAGGCACCTGGAACTTGG + Intronic
1024191929 7:47020923-47020945 CTCACCACACATCTCGAACATGG - Intergenic
1024534153 7:50416335-50416357 CTGATAGAACACCTGGAATATGG - Intergenic
1026122891 7:67552868-67552890 CTGAACTTTCACCTGGAACATGG + Intergenic
1028160334 7:87476999-87477021 CTGGCCAGACAGCTGGTACATGG - Intronic
1028743452 7:94301877-94301899 CTGCCCAAAAATCTGGAACTGGG - Intergenic
1031934702 7:127724823-127724845 TTGACCAAAGACCTGGAAAATGG + Intronic
1032274207 7:130440506-130440528 CTGACCAAACCTTTGGAAAACGG - Intronic
1032688497 7:134259268-134259290 CTGAGTAAAGACCTTGAACAGGG + Intronic
1036585222 8:10117395-10117417 CTGACCAGAGAGCTGGATCAGGG - Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1040025205 8:42775424-42775446 CTCACCACACTCCTGGGACATGG - Intronic
1042092159 8:65170312-65170334 CTAACAAAACACCTGGAGGAGGG - Intergenic
1042134515 8:65620217-65620239 ATGACTAAACACTTGGAATATGG + Intronic
1042700104 8:71602747-71602769 CAAGCCAAACACCTGAAACATGG - Intergenic
1043357104 8:79426489-79426511 ATGACGAAACACCTGAGACAGGG + Intergenic
1044834616 8:96283521-96283543 CTGACAAAACACCTCTGACATGG - Intronic
1048289640 8:133170921-133170943 CTGGCCAAACATCTGGCACATGG - Intergenic
1050369345 9:4904432-4904454 CTGCCAAAAAACCTGGAAAAGGG + Intergenic
1052866559 9:33467743-33467765 CTGACCACCCTCCTGGAGCAGGG - Exonic
1053338838 9:37304201-37304223 ATAACCGAACACCTGGAAGATGG + Exonic
1186578962 X:10796630-10796652 CTGGCCAATCACCCTGAACAAGG - Intronic
1188233531 X:27697073-27697095 CTGACCTAACCCCTGGTACTTGG + Intronic
1192126225 X:68503210-68503232 TTGACCAAAATCCTGGAAAAAGG - Intronic
1199448882 X:147957688-147957710 CTGAACTAACACATGGAACATGG - Intergenic