ID: 1004430469

View in Genome Browser
Species Human (GRCh38)
Location 6:15538140-15538162
Sequence CACAGCTGACTCCTTAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004430458_1004430469 30 Left 1004430458 6:15538087-15538109 CCTAGGCCTGGGGCTGGGATGGA 0: 1
1: 0
2: 13
3: 90
4: 613
Right 1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 138
1004430459_1004430469 24 Left 1004430459 6:15538093-15538115 CCTGGGGCTGGGATGGATTTTAC 0: 1
1: 0
2: 1
3: 13
4: 124
Right 1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 138
1004430461_1004430469 2 Left 1004430461 6:15538115-15538137 CCCTGTGCCTAGGTGATGTCCAT 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 138
1004430462_1004430469 1 Left 1004430462 6:15538116-15538138 CCTGTGCCTAGGTGATGTCCATG 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 138
1004430464_1004430469 -5 Left 1004430464 6:15538122-15538144 CCTAGGTGATGTCCATGGCACAG 0: 1
1: 0
2: 1
3: 21
4: 207
Right 1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004430469 Original CRISPR CACAGCTGACTCCTTAAAGG GGG Intronic
900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG + Intergenic
900838638 1:5028191-5028213 CACAGCTGACTAGTCAAATGGGG - Intergenic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
905072871 1:35242851-35242873 ATCAGCTGACTCTTTAAAAGAGG + Intergenic
907274961 1:53311813-53311835 AGCATCTGACTCCTTAATGGTGG - Intronic
907821106 1:57970360-57970382 CAAAGCTGACCCTTTGAAGGAGG - Intronic
909277392 1:73705188-73705210 CACATGTGACTCATTGAAGGAGG - Intergenic
910935298 1:92481826-92481848 CAGAGCTGTCTCCTTGCAGGTGG - Intronic
917055178 1:170973180-170973202 CTCAGCTAAATACTTAAAGGGGG - Intronic
919303352 1:195798911-195798933 CACAGCTGTGTCCTTAACGTTGG - Intergenic
920887228 1:209941208-209941230 CACATCTGACTGATAAAAGGAGG - Intronic
922697699 1:227739814-227739836 CACAGCTGAATCCTCGAGGGAGG - Intronic
923778841 1:237003825-237003847 CACAGCAGACAAATTAAAGGTGG - Intergenic
1064306838 10:14175135-14175157 AACTGGTGACTCCTTAAATGTGG + Intronic
1065903332 10:30227287-30227309 CACAGCTGAGTCCTTCAGGCTGG + Intergenic
1069809527 10:71148130-71148152 CACAACTGCCTCCTTCAGGGAGG + Intergenic
1071683806 10:87734297-87734319 CAGTGCTGACTTCTGAAAGGAGG - Intronic
1072122446 10:92416155-92416177 CAATGCTGACTCCTGAAATGTGG - Intergenic
1073143982 10:101267031-101267053 CACAGCTGAATACTTGAAGGTGG - Intergenic
1078877981 11:15417173-15417195 CAAGGAAGACTCCTTAAAGGAGG - Intergenic
1079422148 11:20303677-20303699 CACAGTTGACTGCTTTAATGTGG + Intergenic
1080292894 11:30690764-30690786 CACTGCTGACTCCACAAAAGGGG + Intergenic
1081524873 11:43920625-43920647 TACAGGTGACTACTTGAAGGTGG - Intergenic
1081835464 11:46149812-46149834 CCCAGATGACTCTTTAATGGTGG + Intergenic
1082092097 11:48098424-48098446 CACAGCTGCCTTCTCAAAGCAGG - Intronic
1083578951 11:63813170-63813192 CCCAACTGACTTCTTAATGGAGG + Intergenic
1083713775 11:64564289-64564311 CACACCTGCCTCCTTACAGGTGG + Exonic
1084077511 11:66792157-66792179 CACAACTAACCCCTTAAAAGGGG - Intronic
1084566719 11:69932813-69932835 CCCTGCTGACTCTTTCAAGGGGG + Intergenic
1090253348 11:125265943-125265965 CACAGCTGTCTCCTGATGGGCGG - Intronic
1094525373 12:31227586-31227608 CAGAGCTGGCTTCTCAAAGGCGG + Intergenic
1096485236 12:51975837-51975859 CAAAGGTGACTCCTCAAGGGAGG + Intronic
1101102551 12:101408300-101408322 CACTGCCGACCCCTGAAAGGCGG - Intergenic
1103057123 12:117830337-117830359 CACAGGGGACTCCTAGAAGGGGG + Intronic
1103133714 12:118489820-118489842 CAGAGCTGATTTCTTAAAGCAGG - Intergenic
1104013206 12:124946712-124946734 CACTGCTGTCTGCTTTAAGGAGG - Intergenic
1104137322 12:125952841-125952863 CACAACTGCCTCCATAAAGTGGG + Intergenic
1109210385 13:59528337-59528359 CATAGCTGAATGCTTAAGGGTGG + Intergenic
1109369741 13:61407359-61407381 CAGAGAAGACTCCCTAAAGGAGG - Intergenic
1110430533 13:75417649-75417671 CACACTTGATTCCTTAAAGGAGG - Intronic
1112336325 13:98520186-98520208 AACAGCTGAGTTCTCAAAGGGGG + Intronic
1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG + Intronic
1120793843 14:88609729-88609751 CAGAGCTGACTACTGGAAGGTGG - Exonic
1121468804 14:94135756-94135778 CCCTGCTGACACCTTAAATGTGG + Intergenic
1126104722 15:45139953-45139975 AACAGCTGACTCCTGAAAGGTGG - Intronic
1126705399 15:51401030-51401052 AACAGCGGCCTCATTAAAGGAGG + Intronic
1129382910 15:75178923-75178945 CCCAGCTGAATCCTAATAGGAGG - Intergenic
1130363207 15:83208885-83208907 GCCAGCTGACCCCTTAAAGGAGG - Intergenic
1132805734 16:1774255-1774277 CACAGCTGCCTCCTGAAGTGTGG + Exonic
1132838580 16:1967117-1967139 CACAGCTGCCCCCTCAAAGTGGG + Intronic
1133537751 16:6718517-6718539 AAATGCTGCCTCCTTAAAGGTGG - Intronic
1138319975 16:56103442-56103464 CATATCTGACTCCTGAAACGAGG + Intergenic
1138791200 16:59906096-59906118 AATAGCTGCATCCTTAAAGGAGG - Intergenic
1140118396 16:72062572-72062594 TACAGATGGCTCCTTAGAGGAGG - Intronic
1141300240 16:82808439-82808461 CAGAGCTGAATCCTTATAGGAGG + Intronic
1142395788 16:89830500-89830522 GCCAGCTGTCTCCTCAAAGGTGG + Intronic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1145034499 17:19531687-19531709 AACTCCTCACTCCTTAAAGGTGG - Intronic
1146180859 17:30697495-30697517 CACATCGCACTCCTCAAAGGGGG + Intergenic
1147303865 17:39550042-39550064 CACAGCTGAGCCTTAAAAGGGGG + Intronic
1149827382 17:59841999-59842021 CACAGCTGAACACTTAAAAGAGG - Intronic
1154197151 18:12274954-12274976 CACAGCTGATTCCTTAGAGCAGG - Intronic
1155227153 18:23738618-23738640 CACAGCTGTGTCCTCACAGGTGG - Intronic
1155228893 18:23754999-23755021 CACTGCCGAATCCTTGAAGGGGG - Intronic
1156363469 18:36404445-36404467 AGCAGCTGACACCTAAAAGGAGG + Intronic
1158807871 18:60997119-60997141 CACAGATGAGTCATTTAAGGTGG + Intergenic
1159228119 18:65567537-65567559 CATAGCTGACTCCCTAGAGGAGG - Intergenic
1160220060 18:76969004-76969026 GACAGCTGAATCCTTATTGGTGG - Exonic
1161436081 19:4263868-4263890 CACAGCTGACTCATCCAAGGTGG + Intronic
1163125342 19:15241398-15241420 CACGGATGACTCCTGAAAGCTGG + Intronic
1163609740 19:18294674-18294696 CACAGCCGCCTCCTCACAGGGGG - Intergenic
1166673553 19:44725570-44725592 CGCCCCTGACTCCTTAAAGCTGG - Intergenic
1168100664 19:54139266-54139288 GAGAGCTGACACCCTAAAGGAGG - Intronic
1168409584 19:56131163-56131185 TACAGATGAGTCCTCAAAGGCGG - Intergenic
926335738 2:11861407-11861429 CACAGCCCACTCCTTAACTGGGG - Intergenic
929759602 2:44796231-44796253 AACAGCTAACTCTTTAAGGGAGG + Intergenic
930285294 2:49420765-49420787 AATAGCTGAGTCCTGAAAGGCGG + Intergenic
932305104 2:70696340-70696362 CACAGCTGACTCCCTGAACCTGG - Exonic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
937002068 2:118477045-118477067 CACAGTTGACTCCTCAGAGGTGG + Intergenic
939990939 2:148876103-148876125 CAGAGCTCACACTTTAAAGGGGG - Intronic
940360229 2:152788786-152788808 AACTGCTGACACCTTAAATGAGG - Intergenic
940820742 2:158352364-158352386 CACAGAGAACTGCTTAAAGGAGG + Intronic
942294824 2:174507292-174507314 CTCAGCTGACTGCTTAGAGCTGG - Intergenic
942295046 2:174508597-174508619 CTCAGCTGACTGCTTAGAGCTGG - Intergenic
943481417 2:188423977-188423999 CACAGCTTCCTCCTGAAATGAGG - Intronic
944488240 2:200229588-200229610 CAGAGAAGACTTCTTAAAGGAGG - Intergenic
945468286 2:210196894-210196916 CACAGCTGTGTTCTCAAAGGAGG + Intronic
947449918 2:230198319-230198341 CAGAGCTGCCTCCTGCAAGGGGG + Intronic
948159448 2:235812215-235812237 CACAGCTGACTCCCTGGAGGTGG - Intronic
1169753268 20:9017148-9017170 CACAGAAGCCTTCTTAAAGGTGG + Intergenic
1170626509 20:18034188-18034210 CAGTGCTGATTCCTTAAAGAAGG - Intronic
1171287233 20:23951311-23951333 CACAGCTGAGTCCTTCAATGGGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172204693 20:33154723-33154745 CACAGCTGTCCCCTTAAAAGAGG + Intergenic
1175320421 20:58083335-58083357 CAGACCTGACTTTTTAAAGGGGG - Intergenic
1178195291 21:30337918-30337940 CAAAGATGACTCATTCAAGGTGG + Intergenic
1178375169 21:32060840-32060862 CACACTTGACTCATTAAAGCAGG - Intergenic
1179455808 21:41499044-41499066 CACAGTTGACTTTTTAAAGCAGG + Intronic
1179724273 21:43333110-43333132 GAGAGCTGACTCCTTTAAGCTGG - Intergenic
1180072125 21:45441841-45441863 CACGGCTCTCTCCATAAAGGAGG + Intronic
1180935596 22:19623090-19623112 GACACCTGACTCCTTTAAGAGGG - Intergenic
1184907190 22:47496763-47496785 CAGAGCTGACACCTAAAAGCAGG - Intergenic
954468303 3:50671005-50671027 CAAAGCTGCCTCCTGAAAGGAGG + Intergenic
954747570 3:52795707-52795729 AACAGCTGACTCCTCACAGCTGG + Intronic
955141865 3:56277647-56277669 CAAAACTGACTCCTAAATGGTGG + Intronic
955969692 3:64425882-64425904 CACAGGGGAATCCTAAAAGGGGG - Intronic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
960349070 3:116571986-116572008 CACATCTATCTCCATAAAGGAGG - Intronic
961194900 3:124993447-124993469 CTCAGCTGCCTCCTTAGAGAAGG - Intronic
965322707 3:167268092-167268114 CAGAGCTGACTCCATAGATGTGG - Intronic
966057691 3:175715987-175716009 CACAGCTCATTCCTTACAGTAGG - Intronic
966787181 3:183632278-183632300 CCAAGCTGCCTCCTGAAAGGAGG + Intergenic
972333004 4:38080801-38080823 CTCAGCTGTCTCCTTAGGGGTGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
978113370 4:104989588-104989610 CTCAGCTGACTGCTTATAGCAGG - Intergenic
983534439 4:168842303-168842325 CACAGCAGTCTGATTAAAGGTGG + Intronic
987866852 5:23552803-23552825 CACTGCGGCCTACTTAAAGGTGG - Intergenic
988985500 5:36614568-36614590 CACAGCAGACTACTTAGTGGAGG + Intronic
990683374 5:58271196-58271218 CTCAGCTGACTCCTTTAGGATGG + Intergenic
991441451 5:66654265-66654287 CCCTTCTGACTGCTTAAAGGAGG - Intronic
995269980 5:110208908-110208930 CACTGGGGACTCCTTGAAGGGGG - Intergenic
995502041 5:112817843-112817865 CACAGCTTGCTCCTAAGAGGTGG + Intronic
999058356 5:148606527-148606549 CAAAACTGACTCCTTAGATGAGG + Intronic
1001959217 5:175870321-175870343 CACAGCAGAGGCCTTAAAGCAGG - Intronic
1002373474 5:178772614-178772636 CACAGTGGACTCCTTTGAGGAGG - Intergenic
1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG + Intronic
1005666691 6:28064639-28064661 CCCTGCTGACACCTTGAAGGAGG - Intergenic
1011130475 6:84046996-84047018 CAAAGCTGGATCCTTGAAGGTGG + Intronic
1012058130 6:94442195-94442217 TACAGCTGACTACTAGAAGGTGG + Intergenic
1013040346 6:106426712-106426734 CGCAGCTGGCTCCTAAGAGGAGG + Intergenic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1014735880 6:125095799-125095821 CACAGCTGCATCATTAAAAGGGG - Intergenic
1017690668 6:156961131-156961153 CACAGCTTACTCCAGAAAGAAGG + Intronic
1022864347 7:34401549-34401571 CACTGCTGCCTCCCAAAAGGGGG + Intergenic
1024462172 7:49670200-49670222 CACCGCGGACTCCTGGAAGGTGG - Intergenic
1029426431 7:100497168-100497190 CACAGCTGACCTCTGCAAGGAGG + Intergenic
1030750162 7:113222820-113222842 CTCAGCTGTCTCCGTAAAGATGG + Intergenic
1030786999 7:113674673-113674695 AACAGCTGCCTCCTTAAAAATGG - Intergenic
1031939017 7:127767368-127767390 CACAGCTGCCTTCTTATATGTGG + Intronic
1036588226 8:10144785-10144807 CACAGCTGGCTCATCAGAGGTGG + Intronic
1039689762 8:39851209-39851231 CAGAGCTGACTCCTTAGATGTGG + Intergenic
1039936215 8:42048487-42048509 CACGGCAGACTCCTTAAAGATGG - Exonic
1047862984 8:128989406-128989428 CACTGGGGACTCCTTGAAGGAGG - Intergenic
1049311915 8:141937909-141937931 CACAGATGCCTCCTCAAAAGGGG - Intergenic
1054870683 9:70044825-70044847 CACAGCTGAGGGCTTGAAGGAGG - Intronic
1057078105 9:92151199-92151221 CACAGCTGAACACTTAAAAGAGG - Intergenic
1057644400 9:96859467-96859489 CAAAGCTGAGACCTGAAAGGGGG - Intronic
1058706926 9:107645237-107645259 TACAGCTGGCTTCTGAAAGGAGG - Intergenic
1060302957 9:122386603-122386625 CATGCCTGACTCCTTCAAGGTGG + Exonic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1192767180 X:74152659-74152681 CACAGGTGCCTCCTTGAGGGTGG + Intergenic
1194409322 X:93538078-93538100 CAAAGCTGACTGGTTAAAGGAGG + Intergenic
1198971818 X:142290215-142290237 CACAGCTGAGTCCTTAAGCTTGG + Intergenic
1198977793 X:142356591-142356613 CACAGCTTACTCTTTATAGTAGG - Intergenic
1200176486 X:154120709-154120731 CACAGGTGACTCCTTAGAGCAGG - Intergenic
1202175551 Y:22095727-22095749 CATACCTGAGTCCTTAGAGGTGG + Exonic
1202215810 Y:22490655-22490677 CATACCTGAGTCCTTAGAGGTGG - Exonic