ID: 1004432987

View in Genome Browser
Species Human (GRCh38)
Location 6:15563141-15563163
Sequence TGAGTAGGAGGTAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004432987 Original CRISPR TGAGTAGGAGGTAAGATGGG AGG (reversed) Intronic
901254738 1:7813095-7813117 TTAGTATGAGTTAATATGGGAGG + Intronic
902111532 1:14082837-14082859 TAAGTGGGAGGTAAAGTGGGAGG - Intergenic
903345677 1:22682646-22682668 AGAGTGGGAGGGAGGATGGGTGG - Intergenic
904493453 1:30874102-30874124 TGGGAAGGAGGAAAGTTGGGAGG + Intronic
904548846 1:31298197-31298219 TATATAGGAGGTAAAATGGGTGG + Intronic
904770329 1:32877676-32877698 TGGGTCGGAGGTATGAGGGGAGG - Intergenic
905831620 1:41073674-41073696 TGGGTAGGAGGGTAGGTGGGTGG - Intronic
907915590 1:58865897-58865919 AGAGTAGGAGTTAGGATGGATGG + Intergenic
908520376 1:64935633-64935655 TGAGTAGGAGGAAAGAGGACAGG - Intronic
908798497 1:67854871-67854893 TGGGCAGGAGGTAGGAAGGGGGG - Intergenic
909141849 1:71877058-71877080 AGATTAGGAGGTAAAATGTGAGG + Intronic
909602474 1:77474693-77474715 TAAGAAGGAAGTAAGATTGGGGG - Intronic
909641649 1:77874613-77874635 TGAGTAGTAAGTAGGGTGGGTGG + Intronic
909847570 1:80414967-80414989 TGAGAGGGAGGAAAGAAGGGAGG + Intergenic
910680061 1:89853813-89853835 TGAGGAGGAGTTAAGAAGTGGGG + Intronic
910683868 1:89896218-89896240 TGAGTGGGAGGGTAGAGGGGTGG + Intronic
911249898 1:95563644-95563666 TAAGTAGAAGGTAAAGTGGGAGG + Intergenic
912313701 1:108647529-108647551 TGGGGAGGAGGTGAGGTGGGAGG + Intergenic
912782384 1:112563533-112563555 TGAGTCAGAGGTAATATGGAAGG - Intronic
915289747 1:154875434-154875456 TGAATGGGAGGATAGATGGGTGG + Intergenic
916671513 1:167026004-167026026 TGAATTGGAGGTAAGATTGAAGG + Intergenic
920942016 1:210492436-210492458 TGAGTGGATGGTTAGATGGGGGG + Intronic
922073574 1:222220476-222220498 AGTGAAGGAGGTAGGATGGGAGG + Intergenic
922477521 1:225916779-225916801 TGAGAAGGTGGGAAGCTGGGAGG + Intronic
923103934 1:230839545-230839567 TGAGGAGGGGGAAAGTTGGGTGG + Exonic
923650421 1:235867726-235867748 TGACTAGGAGGTGAGGAGGGTGG - Intronic
1064073167 10:12247502-12247524 TGAGGGGGAGGTAAGAGAGGAGG - Intronic
1064347085 10:14541892-14541914 GCAATAGGAGGTAAGATGAGAGG - Intronic
1065177660 10:23095349-23095371 AGAGTGGGAGGAAAGAGGGGCGG + Intergenic
1065996653 10:31065611-31065633 TGAGTGGGAGCTAAGCTGTGAGG + Intergenic
1067146342 10:43696187-43696209 TGGGGAGGATGGAAGATGGGAGG - Intergenic
1067307306 10:45076335-45076357 TGAGTATGTGGTAATATTGGAGG + Intergenic
1068819085 10:61352320-61352342 TGAGAGGGAGGAAGGATGGGAGG + Intergenic
1069605654 10:69737277-69737299 TGAGTTGGTGGTGGGATGGGAGG - Intergenic
1069858322 10:71453991-71454013 TTGGTTGGAGTTAAGATGGGAGG + Intronic
1070105592 10:73427832-73427854 TGTGTAGGAGACAAGATGGGGGG - Intronic
1070665014 10:78336611-78336633 TGAGCAGGAAGGAAGAGGGGAGG + Intergenic
1072246410 10:93547705-93547727 TGGGTAGGTGGATAGATGGGTGG + Intergenic
1072516845 10:96192154-96192176 TGAGAATGAGAGAAGATGGGAGG - Intronic
1074116468 10:110460522-110460544 TGAGGAGGGGGGCAGATGGGAGG - Intergenic
1074506803 10:114078087-114078109 GGGGCAGGAGGTAAGATGGAAGG - Intergenic
1076136732 10:128050270-128050292 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136763 10:128050399-128050421 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076136777 10:128050454-128050476 TGAGTGGGAGGGCAGATGGATGG + Intronic
1076656317 10:132026064-132026086 TGAGAAGGAAGTGAGGTGGGAGG + Intergenic
1076867440 10:133175012-133175034 TGGGTGGGTGGAAAGATGGGTGG + Intronic
1077896896 11:6459704-6459726 TAAGAAGGAGGGAAGGTGGGAGG + Intronic
1078267764 11:9767596-9767618 TGAGCAGGAGGTACACTGGGAGG - Intergenic
1078803906 11:14676974-14676996 TGGGTATGAGGTAAGGTAGGGGG + Intronic
1078946924 11:16078713-16078735 TGAGTATGGGGTAGGCTGGGAGG + Intronic
1079105946 11:17572500-17572522 AGAGTAGGAGGTGAGAAGGGGGG - Intronic
1080616958 11:33952946-33952968 TGAGTAGGAGGAAGGAAAGGGGG - Intergenic
1081936462 11:46907406-46907428 TGAGAAAGTGGTAAGATGGCGGG - Intronic
1084460523 11:69294333-69294355 TGAGTGGGAGCTAATATGGCTGG - Exonic
1084464377 11:69313548-69313570 TGTGTGGGGGGGAAGATGGGAGG + Intronic
1084565297 11:69925095-69925117 TGAGTAGGTGGATGGATGGGTGG + Intergenic
1084742677 11:71149813-71149835 TGAGAGGGAGGAAAGAAGGGAGG + Intronic
1084768007 11:71324964-71324986 TGAGGAGGAAGTAAGAGAGGAGG + Intergenic
1084791974 11:71480865-71480887 TGAGGAGGAGATAAGGTGTGTGG + Exonic
1084958725 11:72704855-72704877 TGACAAGGAGGCAAGGTGGGGGG - Intronic
1085410056 11:76285550-76285572 TGAGGAGGTGGGAAGATTGGAGG - Intergenic
1085731776 11:79006205-79006227 TGAGTAGGGGGTAGAAAGGGAGG - Intronic
1086394792 11:86403666-86403688 TGAGAGTGAGGTAATATGGGTGG + Intronic
1086620080 11:88877064-88877086 AGAGTAGCAGGGAAGAGGGGAGG + Intronic
1086964127 11:93010018-93010040 AGAGCAGCAGGTAGGATGGGTGG + Intergenic
1088920139 11:114254706-114254728 GAAGGAGGAGGTATGATGGGAGG - Intergenic
1089005180 11:115084891-115084913 TGAGTAGGAACTCAGAGGGGTGG - Intergenic
1089527922 11:119108771-119108793 TGAGATGGAGATAAGGTGGGAGG + Intronic
1089541985 11:119194824-119194846 AGAGTTGGAGGTATGGTGGGGGG - Intronic
1089690254 11:120182736-120182758 AGAGGAGGAGGGAAGAGGGGAGG + Intronic
1089808892 11:121115229-121115251 TGAGTAGGTGGATGGATGGGTGG - Intronic
1090320277 11:125837231-125837253 TGACCAGGAGGTAAGAGGAGAGG - Intronic
1090994446 11:131852783-131852805 TGAATGGGTGGTTAGATGGGTGG - Intronic
1091399295 12:172761-172783 TGAGAAGGGGGTCAGATGAGAGG + Intronic
1092229698 12:6769708-6769730 TGATTGGGAGGGAAGATGGTAGG - Intronic
1093185867 12:16019543-16019565 TGTGTTGGAGGTGAGGTGGGAGG - Intronic
1094456816 12:30644260-30644282 TACTCAGGAGGTAAGATGGGAGG + Intronic
1094751813 12:33418267-33418289 AAAGTAGGAGGGAAGCTGGGAGG - Intronic
1095603634 12:44042599-44042621 GGAGAAAGAGGTAAGCTGGGAGG - Intronic
1096262920 12:50104146-50104168 TGGGTAGGAGGCAGAATGGGTGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097706179 12:62870653-62870675 GGATTAGGAGGGAATATGGGAGG + Intronic
1098551782 12:71770350-71770372 TGAGGAGGAGGAAGGTTGGGAGG + Intronic
1099389303 12:82059416-82059438 GGAGGAGGAGGGAAGAAGGGAGG + Intergenic
1099776146 12:87134371-87134393 TGAGTAGGAAGTTAGCTGTGTGG + Intergenic
1100387388 12:94116221-94116243 TGTGTAGGATGTGAGATAGGGGG + Intergenic
1101388767 12:104281124-104281146 AGAGGAGGAAGAAAGATGGGAGG - Intronic
1101877521 12:108605691-108605713 TGGTTAGGTGGTTAGATGGGTGG + Intergenic
1101877566 12:108605909-108605931 TGGTTAGGTGGTTAGATGGGTGG + Intergenic
1102791234 12:115647496-115647518 TGAGTAGGAGGCAAGAGGCCAGG - Intergenic
1102920635 12:116789150-116789172 TGAGTAGATGGATAGATGGGTGG + Intronic
1102920800 12:116789850-116789872 TGAGTAGATGGATAGATGGGTGG + Intronic
1103245477 12:119453289-119453311 GGAGGAGGAGGGAAGAGGGGAGG - Intronic
1103364388 12:120370716-120370738 GGAGTAGAAGGTGAGTTGGGAGG - Intergenic
1104554729 12:129789275-129789297 TAAGTAGGAGCTAAGCTGTGAGG - Intronic
1104982709 12:132581442-132581464 TGGGTTGGAGGCAGGATGGGCGG - Exonic
1105212320 13:18264434-18264456 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
1106358449 13:29007306-29007328 GGAGTAGGAGTTGAAATGGGAGG - Intronic
1106816794 13:33417754-33417776 GGACTAGGAGGTAAGACTGGGGG + Intergenic
1107112055 13:36708618-36708640 TCAGAAGGGGGAAAGATGGGAGG - Intergenic
1108509902 13:51147233-51147255 TGTGTAGGAGATAAGAAAGGGGG - Intergenic
1108772180 13:53717158-53717180 TGTGGAGGAGGTGAGATGGGAGG + Intergenic
1110832553 13:80047786-80047808 TTAAGAGGAGGTAGGATGGGTGG + Intergenic
1111436439 13:88215939-88215961 TGAGAAGGAGGAAGGATAGGAGG + Intergenic
1111558163 13:89908872-89908894 TGAGTAGGGGGAAAAATTGGGGG + Intergenic
1113935102 13:113989735-113989757 TGAGTGGGTGGGTAGATGGGTGG - Intronic
1114644965 14:24250495-24250517 TCAGCAGGAGGAATGATGGGGGG - Intronic
1114822363 14:26036614-26036636 TTTGTAGGAGATAAGATTGGGGG - Intergenic
1114969900 14:28013152-28013174 TCAGAAGGAGGAAAGCTGGGAGG - Intergenic
1115333525 14:32222654-32222676 TGAGTAGGTGGTAAAATGGTAGG - Intergenic
1115386633 14:32805415-32805437 CGTGTAGGAGGAGAGATGGGTGG + Intronic
1116057603 14:39883393-39883415 TGAGTGGGTGGTAAGAGAGGAGG - Intergenic
1116222744 14:42110447-42110469 GGGATAGGAGGCAAGATGGGAGG + Intergenic
1116992824 14:51293693-51293715 GGAGCAGGAGGTATCATGGGCGG + Intergenic
1117068178 14:52031689-52031711 GGAGGAGGTGGTAAAATGGGTGG - Intronic
1117351282 14:54884292-54884314 CGAGTAGGAGGAAAGGTGGAGGG + Intronic
1117413043 14:55468046-55468068 TGAGTAGGAGGTATGTTTTGTGG + Intergenic
1118013163 14:61630615-61630637 TTGGTAGTAGGTAAGATGTGAGG + Intronic
1119771206 14:77221429-77221451 TGAGTGGGAGGTGAGTGGGGAGG - Intronic
1122342987 14:101040570-101040592 TGAGTAGGTGCAAAGATGGTAGG + Intergenic
1122879835 14:104685786-104685808 TGAGTAGGTGGGTGGATGGGTGG + Intergenic
1122879922 14:104686090-104686112 TGGGTAGGTGGTTAGATGGGTGG + Intergenic
1123402348 15:20000242-20000264 AAAGTAGGGGGTAAAATGGGTGG + Intergenic
1123511687 15:21006908-21006930 AAAGTAGGGGGTAAAATGGGTGG + Intergenic
1123705868 15:22950853-22950875 TGAGATGGCGGTGAGATGGGCGG - Intronic
1125973739 15:43933247-43933269 GGAGAAGGAGGCAAGATAGGAGG + Intronic
1126333723 15:47563904-47563926 GGAGTAGGAAGGAAGATGTGAGG - Intronic
1127625405 15:60775600-60775622 TGAGTAGGGGGTAATCAGGGAGG - Intronic
1127918713 15:63476416-63476438 TGAGCATGAGGTCAGAGGGGAGG + Intergenic
1128426070 15:67543185-67543207 TGAGGGGGAGGGAAGAGGGGAGG - Exonic
1133454512 16:5930723-5930745 TGAGTAGGTGGGCAGGTGGGAGG + Intergenic
1133501540 16:6372072-6372094 TGGGTAGGAGGGTGGATGGGTGG + Intronic
1134234531 16:12455105-12455127 GGAGTAGGAGGCAAGATAGCTGG + Intronic
1136174355 16:28506984-28507006 GGGGTGGGAGGTATGATGGGGGG + Intronic
1136362852 16:29792340-29792362 AGGGTAGGAGGGAAGAGGGGAGG - Intronic
1137598760 16:49742328-49742350 TGAGAGGGAGGGAAGAGGGGAGG + Intronic
1138000693 16:53276062-53276084 TGAGTAAGTGTTAAGATGTGGGG - Intronic
1138153963 16:54685861-54685883 GGAGGAGGAGGGAAGAGGGGAGG - Intergenic
1138409036 16:56823165-56823187 TGAGTGGGAAGGAAAATGGGAGG + Intronic
1138614544 16:58154474-58154496 TGAGTATGAGGTAATTTTGGGGG - Intergenic
1139928160 16:70503570-70503592 TAAGTAGGAGTTAAGATGTGAGG - Intronic
1140067738 16:71625543-71625565 TGAGTGGGCGGGTAGATGGGTGG + Intergenic
1140167230 16:72565064-72565086 TGAGTAAGAGATAAAATGGTAGG + Intergenic
1140951736 16:79825030-79825052 TGAGTGGAAGGATAGATGGGTGG - Intergenic
1141412323 16:83843961-83843983 TGAGTAGGAGGGAAAAGGGGAGG + Intergenic
1141666775 16:85469860-85469882 CGAGTGGGAGGCAAGGTGGGAGG + Intergenic
1141775794 16:86121869-86121891 GGAGTAGGAGGGAGGAAGGGAGG - Intergenic
1142127272 16:88416427-88416449 TGGGTGGGAGGTAGGACGGGAGG - Intergenic
1142128556 16:88422026-88422048 TGAGTGGGTGGATAGATGGGTGG + Intergenic
1142128610 16:88422213-88422235 TGAGTGGGTGGATAGATGGGTGG + Intergenic
1142248610 16:88980908-88980930 TGGGTAGGTGGATAGATGGGTGG + Intergenic
1144609952 17:16702342-16702364 TCCATAGGAGGTAAAATGGGAGG + Intronic
1144902792 17:18613074-18613096 TCCATAGGAGGTAAAATGGGAGG - Intergenic
1144928268 17:18832904-18832926 TCCATAGGAGGTAAAATGGGAGG + Intergenic
1145129775 17:20333671-20333693 TCCATAGGAGGTAAAATGGGAGG + Intergenic
1145194965 17:20884275-20884297 TCCATAGGAGGTAAAATGGGAGG - Intronic
1146484282 17:33230694-33230716 TGCGAAGGGGGTAAGAAGGGGGG + Intronic
1146924642 17:36735947-36735969 TGTGTCGGAGGTGAGATTGGTGG + Intergenic
1147419308 17:40314270-40314292 TGAGCAGGAGGGAAATTGGGAGG - Intronic
1148763622 17:50022755-50022777 TGGGCAGGAAGTAAGATTGGAGG - Intergenic
1148935319 17:51160483-51160505 TGGGTGGGAGGGAAGTTGGGAGG + Intronic
1149856537 17:60087927-60087949 TGATGAGGGGGTAAGAGGGGAGG + Intergenic
1151360030 17:73583350-73583372 CGAGTGGGAGAGAAGATGGGAGG - Intronic
1151638580 17:75371470-75371492 TGTGTTGGAGGCAAGAAGGGAGG - Intronic
1151973208 17:77469753-77469775 TGGGTGGGTGGTAAGATGGGTGG - Intronic
1152033547 17:77858224-77858246 TGAGTGGGTGGGCAGATGGGAGG - Intergenic
1152617416 17:81344410-81344432 GGCGAAGGAGGCAAGATGGGTGG - Intergenic
1153304552 18:3619995-3620017 TAAGCAGGTGGTAGGATGGGTGG + Intronic
1153944643 18:10008340-10008362 TGAATAGGTGGATAGATGGGTGG - Intergenic
1157656339 18:49393066-49393088 GGAGGAGGAGGAAAGAAGGGAGG + Intronic
1158238655 18:55350773-55350795 GGGGTGGGAGGTAGGATGGGGGG + Intronic
1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG + Intronic
1158308974 18:56138764-56138786 GGAGTGGGAGGTAAGATCAGAGG + Intergenic
1158675293 18:59512854-59512876 TGAGTGGGAGGTAAGAGGAAAGG - Intronic
1159074629 18:63666436-63666458 TGAGTAGGAAGGAGGAAGGGAGG - Intronic
1160675956 19:391510-391532 TCTGTAGGAGGTAAGGTGGGGGG - Intergenic
1160692320 19:465750-465772 TGGGTAGGTGGATAGATGGGTGG + Intronic
1160767865 19:816430-816452 TGGGTAGGTGGGTAGATGGGTGG - Intronic
1161657574 19:5525443-5525465 TGAGTAGATGGTTAGGTGGGTGG - Intergenic
1161657603 19:5525562-5525584 TGAGTAGATGGTTAGGTGGGTGG - Intergenic
1162386133 19:10361670-10361692 TGTGGAGGAGGTGGGATGGGAGG - Intronic
1163394807 19:17053589-17053611 TGGGGGGGAGTTAAGATGGGTGG + Intronic
1164907661 19:31980523-31980545 GGAGTAGCAGGTAGGATGGCCGG - Intergenic
1165136873 19:33675122-33675144 TGAGTAGGAGACAAGAGGGATGG - Intronic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1165168403 19:33872810-33872832 TGGGTAGGAGGATAAATGGGTGG - Intergenic
1165238650 19:34445330-34445352 TAAATAGGAGGTAAAATGAGAGG + Intronic
1165904592 19:39186012-39186034 GGGGAAGGAGGTAAGGTGGGAGG - Intergenic
1167244241 19:48364271-48364293 TGAGTAGGCGGAAAGAGGGAGGG + Intergenic
1167744602 19:51343090-51343112 GGACTGGGAGGTGAGATGGGCGG - Intergenic
1168318976 19:55497782-55497804 TGAGTGGAAAGGAAGATGGGGGG + Intronic
1202637627 1_KI270706v1_random:55924-55946 TGAGAAGGATGTGAGATTGGGGG - Intergenic
925121464 2:1421812-1421834 TGAGTAGGAGCCGAGAGGGGAGG - Intronic
926453365 2:13034989-13035011 GGAGTAGGAAGGAAGATGGTGGG + Intergenic
926805624 2:16707921-16707943 TTAGTATCAGGTAAGATGGTGGG + Intergenic
929105694 2:38363711-38363733 TGTGAAGTAGGTAGGATGGGAGG - Intronic
930002303 2:46869631-46869653 AGAGTAGGAGGGAAGAAGGGAGG - Intergenic
930548634 2:52802640-52802662 TGAGTAGGAGCTTACATGGTTGG - Intergenic
931925055 2:67063363-67063385 GGAGGAGGTGGTAAGATGGTTGG - Intergenic
932785929 2:74603840-74603862 TTAGAGGGAGGTGAGATGGGAGG + Intronic
934301302 2:91777967-91777989 AGAGTAGGAGCTAGGATGGCAGG + Intergenic
935445556 2:103152707-103152729 AGAGTAGAGGGCAAGATGGGTGG + Intergenic
935803381 2:106722618-106722640 TGAGGAGGAGGAGAAATGGGAGG + Intergenic
936291373 2:111226514-111226536 TGTGTGGGAGGAAAGATGGAAGG - Intergenic
936500025 2:113059542-113059564 TGAGCAGGAGGGAGGAAGGGAGG + Intronic
938188769 2:129255762-129255784 TGAGTAGGTGTTTAGGTGGGTGG - Intergenic
938843214 2:135182491-135182513 TGATTTGGAGGGAGGATGGGAGG + Intronic
939567068 2:143797710-143797732 AGAGGAGGAGGTAGGAAGGGTGG - Intergenic
942300997 2:174562425-174562447 TGGGCAGGAGGAAAGGTGGGAGG - Exonic
945002465 2:205366052-205366074 TGAGTGGGGGGATAGATGGGTGG - Intronic
947574921 2:231265526-231265548 TAAGTAGGAGCTAAGATATGAGG + Intronic
947706694 2:232282087-232282109 AGAGTAGGAGGTGAGGAGGGAGG - Intronic
948449402 2:238060167-238060189 TGGGTAAGAGGGAAGACGGGAGG - Intronic
948690332 2:239698043-239698065 TGAGCAGGAGGGAAAAGGGGCGG - Intergenic
948886865 2:240888985-240889007 TGAGTAGGAGCTCAAAGGGGCGG - Intronic
1168830419 20:842350-842372 GGAGAAGGAGGTCAGACGGGCGG - Intronic
1168848709 20:961972-961994 TGGATAGGAGGGTAGATGGGAGG - Intronic
1169069379 20:2713642-2713664 TGAGTAGAAGGAAACATGAGAGG + Intronic
1169286473 20:4311516-4311538 TGAGAAGGAGGTAATTTGAGGGG + Intergenic
1169552815 20:6718673-6718695 AGGGTAGGAGATGAGATGGGAGG - Intergenic
1169620697 20:7503556-7503578 TGTGTAGGAGGGCAGTTGGGGGG + Intergenic
1169624869 20:7554275-7554297 TAAGTGGGAGCTAAGATGTGAGG - Intergenic
1170034018 20:11971160-11971182 TGAGAAGGAGGGAAGAGAGGAGG - Intergenic
1170133489 20:13048643-13048665 TGATTAGGAAGTAAGCTGTGGGG + Intronic
1170438071 20:16350546-16350568 TGGGGAGGAGGGAAGATGGGAGG + Intronic
1170872910 20:20224316-20224338 AGATTCGGAGGTCAGATGGGAGG - Intronic
1170950742 20:20933705-20933727 TGAGCAGGAGGGAAGGTGGGAGG + Intergenic
1171117273 20:22535770-22535792 TGAGCAGGAGGGAAGATGCAGGG - Intergenic
1171395971 20:24833392-24833414 TGAGCAGGAGAGACGATGGGAGG + Intergenic
1172193204 20:33074734-33074756 TGAATAGGAGGCTAAATGGGAGG - Intergenic
1173461889 20:43249445-43249467 TGAGTTGGAGGTTAGAGGGCAGG + Intergenic
1174909042 20:54586673-54586695 TGACTAGGTGTTAGGATGGGAGG + Intronic
1175407464 20:58744324-58744346 TGAGTAGGTGGTTTGATGGGTGG + Intergenic
1175491748 20:59384594-59384616 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491766 20:59384653-59384675 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491784 20:59384712-59384734 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491802 20:59384771-59384793 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491819 20:59384830-59384852 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491837 20:59384889-59384911 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491855 20:59384948-59384970 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491873 20:59385007-59385029 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491891 20:59385066-59385088 TGTGTAGGAGGTAAGCAGGGAGG + Intergenic
1175491908 20:59385110-59385132 TGGGGAGGAGGTGAGAGGGGAGG + Intergenic
1175606188 20:60314338-60314360 TGGGTAGGAGGACAGATGGATGG - Intergenic
1175894812 20:62331293-62331315 GGTGTAGGCGGTACGATGGGGGG + Intronic
1179713229 21:43274852-43274874 TGAGAAGAGGGTTAGATGGGCGG + Intergenic
1180213715 21:46311843-46311865 TGGGTAGGTGGATAGATGGGTGG - Intronic
1180815138 22:18784753-18784775 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
1181164777 22:20977398-20977420 TGGGTAGGGGCCAAGATGGGAGG + Intronic
1181201328 22:21219090-21219112 AGAGTAGGAGCTAGGATGGCAGG - Intronic
1181577168 22:23802421-23802443 GGAGGAGGGGGTAGGATGGGAGG - Intronic
1181700421 22:24617873-24617895 AGAGTAGGAGCTAGGATGGCAGG + Intronic
1183055067 22:35300115-35300137 AGAGTGGGAGGAAAGCTGGGCGG - Intronic
1183149651 22:36028118-36028140 TGGGTTGGAGGTGGGATGGGGGG - Intronic
1183427440 22:37747050-37747072 TGAGTAGGGGGCATGATGGCAGG + Intronic
1183446903 22:37863140-37863162 TGTGTAGGTGGGAAGAGGGGAGG + Intronic
1184083001 22:42238697-42238719 TGAGGAGGTGGTGAGATGGGGGG + Intronic
1184434183 22:44460191-44460213 TGAGTAGCAGGGTAGATGGGTGG - Intergenic
1184653383 22:45929516-45929538 TGAGTGGGTGGAAAGATGGACGG - Intronic
1184855147 22:47142554-47142576 TGGGTAGGTGGATAGATGGGTGG - Intronic
1203225586 22_KI270731v1_random:76340-76362 AGAGTAGGAGCTAGGATGGCAGG + Intergenic
1203265244 22_KI270734v1_random:10444-10466 AGAGTAGGAGCTAGGATGGCAGG - Intergenic
950184032 3:10934204-10934226 TGGGTTGGAGGGTAGATGGGTGG - Intronic
951336260 3:21425724-21425746 AGAGAAGGAGGTGGGATGGGAGG + Intronic
951667946 3:25147708-25147730 TCAGTAGAAGGTAATATGGGAGG - Intergenic
952769429 3:36984422-36984444 AGGGTATGAGGTAAGATGGTAGG + Intergenic
953234915 3:41097813-41097835 TGGGTAAGAGGTGAGCTGGGAGG - Intergenic
953517223 3:43606344-43606366 TGTGTAGGAGGAAAGAAGGGTGG + Intronic
956121839 3:65974319-65974341 AGAGTGGGAGGGAAGAAGGGAGG + Intronic
956612922 3:71142906-71142928 TGAGTAAGAACTCAGATGGGAGG + Intronic
957170291 3:76730140-76730162 GGAGTAGGAGGTGAAATAGGAGG - Intronic
958061045 3:88481521-88481543 TGGGTAGGAGTTAAGATGTAGGG - Intergenic
960956582 3:123036076-123036098 TGAGAAAGGGGTAAAATGGGGGG + Intergenic
961605086 3:128087678-128087700 AGAGCAGGAGGGAAGAAGGGAGG + Intronic
961911073 3:130317311-130317333 TGAGTATAAAGTGAGATGGGTGG - Intergenic
962443001 3:135439857-135439879 TGGGGAGGAGCCAAGATGGGGGG - Intergenic
965341474 3:167497049-167497071 TGAGTAGGAGGTCAAAGGTGAGG - Intronic
965507657 3:169534252-169534274 TGAGTAGAAGGACAGATGGAGGG - Intronic
966738606 3:183211131-183211153 TCAGTAGGTGGTAAGAGGGGGGG + Intronic
966952223 3:184831684-184831706 TGAGTAGGAGTACGGATGGGAGG - Intronic
967184134 3:186930836-186930858 TGAGTAGGGGGTGCGGTGGGCGG + Intronic
969085750 4:4655199-4655221 TGAGGAGGAGGCAAGAAGGGTGG + Intergenic
969905879 4:10395798-10395820 AGGGTTGGAGGCAAGATGGGTGG + Intergenic
970372291 4:15420135-15420157 TGAGGAGGAAGAAGGATGGGGGG - Intronic
970934460 4:21552939-21552961 TGAGTAGGATGTGAAATAGGAGG - Intronic
971964124 4:33529399-33529421 TGAGTGGGTGGGAGGATGGGAGG + Intergenic
973280526 4:48355654-48355676 AGAGTAGGAGGTAAGAGAGACGG - Intronic
973393187 4:49573140-49573162 TGAGAAGGATGTGAGATTGGGGG + Intergenic
973567609 4:52204030-52204052 AGAGAAGGAGGAAAGAAGGGAGG - Intergenic
977178440 4:93842840-93842862 TGGTGAGGAGGTAAGAAGGGAGG + Intergenic
977827452 4:101550582-101550604 TGAGTTGGATGTAGGATGTGAGG + Intronic
977877553 4:102166681-102166703 TGAGAAGGAGGTAAATTTGGGGG + Intergenic
978066131 4:104405109-104405131 TGAGGTGGTGGTAAGATGGCAGG + Intergenic
978932534 4:114332716-114332738 AGAGTGGAAGGTAAAATGGGAGG - Intergenic
979041329 4:115800731-115800753 TGAGTAGGAGAAAGGATGAGAGG - Intergenic
979358878 4:119738251-119738273 TGAGTAGGTGTTAAAATAGGAGG + Intergenic
979957262 4:126969297-126969319 TGAGTAGGAGGTTATTAGGGAGG - Intergenic
980018910 4:127684600-127684622 AGAGGAGGAGGAAAGAGGGGAGG - Intronic
980178141 4:129371815-129371837 TGTGTAGGAGAGGAGATGGGAGG + Intergenic
980980587 4:139651456-139651478 AGAGGAGCAGGCAAGATGGGTGG - Intergenic
981124495 4:141090397-141090419 TAAGTAGCAGAAAAGATGGGTGG + Intronic
981733643 4:147926076-147926098 TGAGTGGGTGGTATGATGTGGGG + Intronic
982419098 4:155172893-155172915 TTAGTGGGAGCTAAGATGTGAGG - Intergenic
983662544 4:170144371-170144393 TAAGTAGGAGCTAAGCTGTGAGG - Intergenic
983747988 4:171225246-171225268 AGAGTAGGAGGTAGGATTAGTGG - Intergenic
1202764944 4_GL000008v2_random:141779-141801 TGAGAAGGATGTGAGATTGGGGG - Intergenic
985662914 5:1166251-1166273 TGAGTAGGTGGATAGATGGATGG - Intergenic
987088843 5:14492950-14492972 TGAGCACGTGGGAAGATGGGTGG + Intronic
988406307 5:30827483-30827505 GGAGTGGGAGGCAAGATGGGTGG + Intergenic
989178268 5:38551364-38551386 CGAGTTGGAGGTAAGGTGAGTGG - Intronic
991512979 5:67400438-67400460 TGTGTAGGAGGTAGTGTGGGTGG - Intergenic
995354803 5:111224868-111224890 CGAGAAGGAGGGAAGGTGGGAGG - Intronic
996775565 5:127128840-127128862 TGTTTAGAAGGTAAGATGGGAGG + Intergenic
997822598 5:137079346-137079368 TCAGCAGGTGGTTAGATGGGTGG - Intronic
998458701 5:142293684-142293706 TGAGTAAGAGGTAGGGTGGGTGG + Intergenic
998680067 5:144457341-144457363 TGAATGGGAGGTCAGAAGGGTGG + Intronic
998773987 5:145578262-145578284 TTTGTAGGAGGTAGAATGGGTGG - Intronic
998972961 5:147612402-147612424 TCAGTAGGTGGTAAGTTGTGCGG + Intronic
998986713 5:147766119-147766141 GGAGAAGGAGAAAAGATGGGGGG - Intronic
999233211 5:150074825-150074847 TGTGTAGGAAGGAAGAGGGGAGG - Intronic
999259821 5:150231067-150231089 TGAGGAGGAGGAAGGATGGGAGG + Intronic
1000117242 5:158165367-158165389 TAAGTAGGAGGTAAAATATGAGG - Intergenic
1000199914 5:158997989-158998011 TGAGGAGGAGGTAGCAGGGGAGG - Intronic
1001093798 5:168760938-168760960 TGTGTAGGAAGCAAGATGAGTGG + Intronic
1001778484 5:174347292-174347314 TGAGTAGATGGATAGATGGGTGG + Intergenic
1001895342 5:175374593-175374615 TCAGAAGGAGGGAGGATGGGAGG - Intergenic
1002315372 5:178339978-178340000 TGATTAGGTGGTGGGATGGGTGG + Intronic
1002642939 5:180639160-180639182 TGAGTAGAAGGATGGATGGGTGG + Intronic
1002642972 5:180639304-180639326 TGAGTAGAAGGATGGATGGGTGG + Intronic
1002659013 5:180777698-180777720 TGGGTGGGAGGGATGATGGGTGG - Intergenic
1004432987 6:15563141-15563163 TGAGTAGGAGGTAAGATGGGAGG - Intronic
1006423238 6:33948541-33948563 TGAGGGGGAGGTAAGAAGGTGGG - Intergenic
1006952669 6:37837179-37837201 GAAGTATGAGGTAAGATGAGGGG + Intronic
1007672937 6:43571330-43571352 TGAGTAGCTGGTAAAATGGAAGG + Intronic
1008043653 6:46829636-46829658 GGAGTAGGAGGAAAGAGGGAAGG - Intronic
1008250752 6:49236912-49236934 TGAGTAGTAGCTAAGCTGTGAGG - Intergenic
1008422533 6:51318631-51318653 GGAGTGGGAGGTGAGAAGGGAGG - Intergenic
1009411692 6:63372478-63372500 GGAGTGGGTGGTAAGAGGGGGGG + Intergenic
1010408268 6:75530987-75531009 TCTGTAGGAGGGAAGATGGGCGG - Intergenic
1010725418 6:79327285-79327307 TGAGTAGCAGGACAGGTGGGTGG + Intergenic
1013598659 6:111684136-111684158 TGAGAAGGAGGGAGGTTGGGAGG + Intronic
1014902962 6:126990178-126990200 TGAGTAGGTGGACAAATGGGTGG + Intergenic
1019555879 7:1631077-1631099 TGAATAGGTGGGTAGATGGGTGG - Intergenic
1020276572 7:6628264-6628286 TGAGCAGGAGGAAAGAGGAGAGG + Intergenic
1020535382 7:9389802-9389824 TGTGTAGGGGGTGGGATGGGGGG + Intergenic
1021150937 7:17149954-17149976 TCTGTAGGAAGTGAGATGGGAGG - Intergenic
1023107272 7:36774805-36774827 GGAGTAGGAGGACAGAAGGGAGG - Intergenic
1023907777 7:44534434-44534456 CGAGTACCAGGTAAGAAGGGAGG - Exonic
1024330432 7:48149299-48149321 TGAGTAGTAGGGAAGAGGAGGGG - Intergenic
1026907541 7:74071202-74071224 TGGGTAGGTGGACAGATGGGTGG - Intergenic
1028913722 7:96236317-96236339 TGCGTAGGAGGCAAGAAGGGGGG + Intronic
1029536327 7:101159857-101159879 TGAGGAGGGGGAGAGATGGGGGG + Intronic
1030963041 7:115950798-115950820 TGAATGGGAGGGAAGAAGGGAGG - Intronic
1031041163 7:116839783-116839805 TGAGGAAGAGGAAAGATGAGGGG + Intronic
1031322838 7:120354640-120354662 TGAGGGGGAGGTGAGGTGGGAGG + Intronic
1031495228 7:122438667-122438689 TTAGGAGGAGCTAAGGTGGGAGG - Intronic
1032216092 7:129958475-129958497 TGAGGAGGAGGTCAGAAGAGGGG - Intergenic
1034416218 7:150965583-150965605 GGAGTTGGAGGGAAGAGGGGTGG - Intronic
1035330296 7:158092303-158092325 TGGGTGGGAGGGAGGATGGGTGG + Intronic
1035565439 8:637710-637732 GGAGCAGGAGGAAAGCTGGGGGG + Intronic
1036244872 8:7107476-7107498 TGGGTAGGTGGATAGATGGGTGG - Intergenic
1036896951 8:12643980-12644002 TGGGTAGGTGGATAGATGGGTGG + Intergenic
1038857863 8:31352550-31352572 TGATTACGTGGTAAGAAGGGAGG + Intergenic
1039845142 8:41320672-41320694 AGAGAAGGAGGTAAGAGGGAGGG - Intergenic
1039893069 8:41697457-41697479 TGTGGAGGAGGTGAGATGTGGGG - Intronic
1040663196 8:49598875-49598897 TGTGGAGGATATAAGATGGGAGG + Intergenic
1040904083 8:52447312-52447334 GGAATTGGAGGTAAGGTGGGTGG - Intronic
1041144963 8:54865350-54865372 AGAGAAGGAGGGAAGAAGGGAGG - Intergenic
1041512970 8:58671701-58671723 TCATCAGGAGGTAAGGTGGGAGG + Intergenic
1041885152 8:62799982-62800004 TGAGTTGGAGCTAAGATATGAGG + Intronic
1042017137 8:64326769-64326791 TAGGTAGGTGGCAAGATGGGTGG + Intergenic
1044854004 8:96455991-96456013 TGAGTAGGAGTTAACCAGGGCGG - Intergenic
1044900241 8:96936193-96936215 TTGGAAGGAGGTAAGATTGGTGG + Intronic
1045878402 8:107009926-107009948 TAAGTAGGAGGTAAGCTATGAGG + Intergenic
1048359678 8:133687202-133687224 GGAGAAGGAGGGAAGATGGGAGG - Intergenic
1049278721 8:141733143-141733165 TGAACACGAGGCAAGATGGGAGG + Intergenic
1050265760 9:3887967-3887989 TGAGTAGCAGGTAGGTTGGGAGG - Intronic
1050366958 9:4881687-4881709 AGAGAAGGAGGGAAGAAGGGAGG - Intronic
1051059974 9:13034483-13034505 TGGGTAGGAGGGAGGATCGGAGG - Intergenic
1051061556 9:13051376-13051398 TGGGTAGGAGACAAGAAGGGTGG - Intergenic
1051583966 9:18707039-18707061 TGTGGAGGAGGTAAGAAAGGGGG + Exonic
1052490729 9:29163848-29163870 AGAGTAACATGTAAGATGGGAGG - Intergenic
1052987921 9:34501730-34501752 TGAGGAGGAGGCAGGAAGGGGGG - Intronic
1056820907 9:89841523-89841545 TGAGGAGGAGGAAGGAAGGGTGG - Intergenic
1057131712 9:92658621-92658643 TAGGAAGAAGGTAAGATGGGTGG - Exonic
1058159891 9:101558234-101558256 TAAGTAGGAGCTAAGCTGTGAGG - Intronic
1059095282 9:111406792-111406814 TGCTTAGGAGGTGAGGTGGGAGG + Intronic
1059692220 9:116696806-116696828 TAAGTAGGAGGATAGATGCGTGG + Intronic
1060754930 9:126205865-126205887 TGAGAAGCAGGGAGGATGGGAGG - Intergenic
1062010993 9:134266735-134266757 TGGGTGGGTGGTAGGATGGGTGG + Intergenic
1062054115 9:134462095-134462117 TGAGTTGAAGGCAAGCTGGGAGG - Intergenic
1062551396 9:137088937-137088959 TGAGGAGCTGGTAAGACGGGTGG - Exonic
1203545694 Un_KI270743v1:126667-126689 TGAGAAGGATGTGAGATTGGGGG - Intergenic
1185835917 X:3345998-3346020 AGAGTAGGAGGAAAGAGGCGGGG + Intronic
1186490788 X:9970502-9970524 CGAGAAGGAGGGAAGAGGGGAGG - Intergenic
1186623456 X:11266115-11266137 TGGGGAGGAGGAAAGAGGGGAGG + Intronic
1186754814 X:12659180-12659202 TGAGTAGGAAGTAAGGTAGTTGG - Intronic
1190288319 X:48975024-48975046 TGGGTAGGAGGATAGCTGGGAGG + Intronic
1190633578 X:52412311-52412333 TGAGTAGTTGGGAATATGGGTGG + Intergenic
1191860204 X:65659958-65659980 ACAGTAGGGGGTAAGGTGGGGGG + Intronic
1192399053 X:70816137-70816159 TAAGTGGGAGCTAAGATGTGAGG - Intronic
1192624223 X:72711347-72711369 TGAGTAGGATGTAGGATTTGGGG + Intronic
1192782011 X:74304069-74304091 TGAGTAGGAGGAAAGTCGGGCGG + Intergenic
1192791802 X:74389212-74389234 TGATTTGGTGGTAAGATGTGAGG - Intergenic
1192984990 X:76388498-76388520 TGAGTAGGAGCTAAGCTATGAGG - Intergenic
1193561306 X:83020762-83020784 TGAGTATGAGGTTAGCTGTGGGG - Intergenic
1196945307 X:120818506-120818528 AGAGGAGGAGATAAAATGGGAGG - Intergenic