ID: 1004437782

View in Genome Browser
Species Human (GRCh38)
Location 6:15613818-15613840
Sequence GGTTGTGTGCAGGCTGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004437782_1004437785 -2 Left 1004437782 6:15613818-15613840 CCATTTACAGCCTGCACACAACC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1004437785 6:15613839-15613861 CCCAATCTCCCATCCCTGCCTGG 0: 1
1: 0
2: 1
3: 38
4: 362
1004437782_1004437792 16 Left 1004437782 6:15613818-15613840 CCATTTACAGCCTGCACACAACC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1004437792 6:15613857-15613879 CCTGGCAGTCTCTCAAACTATGG No data
1004437782_1004437793 24 Left 1004437782 6:15613818-15613840 CCATTTACAGCCTGCACACAACC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1004437793 6:15613865-15613887 TCTCTCAAACTATGGTCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004437782 Original CRISPR GGTTGTGTGCAGGCTGTAAA TGG (reversed) Intronic
900395151 1:2450493-2450515 AGTTGGGGGCAGGCTGTATAGGG - Intronic
900806386 1:4770665-4770687 GGCTGTGTGCAGGCAGCAAGGGG - Intronic
902149678 1:14433236-14433258 GGGTGGGTGCTGGCTGGAAAGGG - Intergenic
903620194 1:24692624-24692646 GATAGTGTGCAGGTTGTAGAAGG - Intergenic
906634511 1:47399850-47399872 GCTTGTGTGTAGGCAGTGAATGG + Intergenic
906730275 1:48074912-48074934 GGTTGTGTGGAGGGAGTAATAGG + Intergenic
910808191 1:91209586-91209608 GTTTGTGTGCAAGGTGTATAAGG - Intergenic
914960873 1:152205826-152205848 AGTTGGAGGCAGGCTGTAAAGGG - Intergenic
915745311 1:158151866-158151888 GGGTCTGTGCAGGCAGTAAGTGG + Intergenic
916432637 1:164746208-164746230 GGTTCAGTGCAGACTGTATAGGG + Intronic
917216081 1:172679383-172679405 GGTTGTGTGCATGCTCTCTAGGG + Intergenic
917674395 1:177305288-177305310 AGTTGTGTGCAGGCTGGCAAAGG + Intergenic
918852190 1:189706881-189706903 GGTTGATTGCAGTCTGCAAATGG - Intergenic
922090867 1:222393886-222393908 GGTTGTCTGCAGTCTGAATATGG + Intergenic
1063894196 10:10662086-10662108 TGCTGTGTGCTGGCTGTTAATGG - Intergenic
1065780334 10:29161029-29161051 GGATGGGAGCAGGCTGTCAAAGG + Intergenic
1067828410 10:49596072-49596094 GGGTGTGTGCTGGGTCTAAAGGG + Intergenic
1069070310 10:63985275-63985297 GTTTGGCTGCAGGCTGTACAAGG - Intergenic
1073448512 10:103595380-103595402 AATTGTGTGAAGGCTGAAAAGGG - Exonic
1075386587 10:122059737-122059759 GGTGGTGTGGAGGCTCTGAAAGG + Intronic
1075901453 10:126046014-126046036 TGTTATGGGCTGGCTGTAAAAGG + Intronic
1079178726 11:18169420-18169442 GGTTGTGTGTTGGCTGTGCAGGG - Intronic
1079538051 11:21539331-21539353 TGCTGTGTACAGGCAGTAAATGG + Intronic
1080142882 11:28943739-28943761 GGCTGGGAACAGGCTGTAAAAGG - Intergenic
1080814665 11:35743247-35743269 GGTTGAGTCCAGCTTGTAAAGGG + Intronic
1084973256 11:72782531-72782553 CGTTGTGTGCATGCTGAGAAGGG - Intronic
1086454846 11:86951161-86951183 GGTTGGGTGAAGCCTGGAAAAGG - Exonic
1089489817 11:118875632-118875654 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489823 11:118875714-118875736 GGTTGTGTGCCGGTTGTATGAGG + Intergenic
1089489830 11:118875799-118875821 GGTTGTGTGCCGGTTGTATGAGG + Intergenic
1089489835 11:118875840-118875862 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489840 11:118875884-118875906 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489844 11:118875925-118875947 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489848 11:118875966-118875988 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1090580582 11:128154263-128154285 GGGTGTGTGAAGGCTGCAAGAGG - Intergenic
1096908426 12:54958183-54958205 GGCTGTGTGCAGGATTTATATGG - Intronic
1099500973 12:83414212-83414234 GGTTGTGTGTACTCTGTTAATGG + Intergenic
1101184831 12:102264904-102264926 GTTTGTGTGTAGGTTTTAAATGG + Intergenic
1101710148 12:107257350-107257372 TGCCTTGTGCAGGCTGTAAAAGG + Intergenic
1101722153 12:107359470-107359492 GGTGGTGTGCTGGCTCCAAAGGG + Intronic
1101875658 12:108595514-108595536 GGTTGTGTGTGGGGTGTATATGG - Intronic
1113435140 13:110285661-110285683 GGTTTTGTTCAGGCTCTCAATGG - Intronic
1118917052 14:70116369-70116391 GTTTGTGTGCAGGGTGGAACGGG + Intronic
1119642448 14:76325386-76325408 GGTTGTCTGCTGGCTTTAATTGG + Intronic
1119675032 14:76547174-76547196 GATTGTGTGCAGGCTGGAGAAGG + Intergenic
1119822262 14:77627222-77627244 TCTTGTGTTCAGGTTGTAAATGG + Intergenic
1126036548 15:44551611-44551633 GGCTCTGTGAAGACTGTAAATGG + Intronic
1126075558 15:44905500-44905522 CCTTGTGTGCAGGCTCTGAAAGG - Intergenic
1126082760 15:44981958-44981980 CCTTGTGTGCAGGCTCTGAAAGG + Intergenic
1127343728 15:58072326-58072348 GGTTGTGTGTGGGTTGTGAATGG - Intronic
1128781200 15:70359832-70359854 GGCTGGGTGCAGGCTGTCCAGGG + Intergenic
1129892670 15:79081819-79081841 TGTTGAGTGAAGGCTGTCAATGG + Intronic
1131638241 15:94260484-94260506 GGTTGTGGGCAGACAGTAAATGG + Intronic
1134191261 16:12122704-12122726 GGGTGTGTGCAGGGTGGAAGCGG + Intronic
1136519281 16:30785985-30786007 GATTCTCTGCAGGGTGTAAATGG - Intronic
1142117623 16:88368234-88368256 GGTTCTGTGGAGGCTGTGACTGG - Intergenic
1142468711 17:150158-150180 GGTCATGTGCAGGCTGGAGAAGG + Intronic
1144421935 17:15106861-15106883 AGTGGTGTGCAGGCTGCAAAAGG - Intergenic
1144745838 17:17613697-17613719 GGTGGTGTGCAGGTTCTCAAAGG - Intergenic
1148531146 17:48393557-48393579 GGTTGTGGACTTGCTGTAAATGG - Intronic
1155053555 18:22167389-22167411 GTTTGTGTCCAGGCTGTGTACGG - Intergenic
1157194358 18:45608725-45608747 GGATGTGTGCATGCTGGAAGTGG - Intronic
1159234388 18:65651875-65651897 TGTTCTGTTCAGGCTGTGAAGGG - Intergenic
1159295291 18:66478723-66478745 GGTTCTGTGCAGAATGTCAATGG - Intergenic
1160403037 18:78624968-78624990 TGTTCTGTGCAGGATGGAAAGGG + Intergenic
1160517316 18:79485673-79485695 GGCTGTGTGGAGGCTGTGACCGG - Intronic
1165505822 19:36228492-36228514 GGATGTGTGTAGACTTTAAATGG + Intronic
1168149344 19:54436404-54436426 GGTCCTGTGCAGGCTGTCCATGG - Exonic
1168208149 19:54867684-54867706 GGTGGTGTGTAGGCTGTATCAGG + Intergenic
928500967 2:31894878-31894900 GATTGTATGGAGGCTGTGAAGGG - Intronic
929311477 2:40431146-40431168 GTTTTTCTGCAGGCTGGAAAGGG + Intronic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
930243045 2:48955876-48955898 GGCTGTTTGCAGTGTGTAAATGG - Intergenic
933861775 2:86476833-86476855 GGTTGTGTTCAGTCTGAAGAAGG + Intronic
938114955 2:128596533-128596555 GGTTTTGTGCAGGCTGCACTGGG + Intergenic
939955882 2:148527306-148527328 GAGTGTGTGGAGACTGTAAAAGG + Intergenic
940440623 2:153711826-153711848 AGTTGTATGCTGGCTGTTAAAGG + Intergenic
940658045 2:156512628-156512650 GATCATGTGCAGACTGTAAATGG + Intronic
946644466 2:221818196-221818218 GGTTTTGTGCAGGCTCTGATAGG - Intergenic
947746908 2:232512575-232512597 GAGTGGGTGCAGGCTGCAAAGGG - Intergenic
948278827 2:236730821-236730843 GGTTGTGTGCAGCCAGCACAGGG - Intergenic
1174037855 20:47679105-47679127 GGATTTGGGCTGGCTGTAAAGGG - Intronic
1175327556 20:58140303-58140325 GGATGTGAGCAGCCTGTGAATGG - Intergenic
1177254105 21:18636971-18636993 AGTTGTGTGAAGGATGTCAATGG - Intergenic
1180836436 22:18932013-18932035 GGTTGTTTCCAGTCTATAAAAGG - Intronic
1180838858 22:18948574-18948596 GGTTTGGTGCAGGCTGATAAAGG - Intergenic
1181051652 22:20240895-20240917 GGGTGTGGGCATGCTGTAAGTGG + Intergenic
1181063331 22:20292571-20292593 GGTTTGGTGCAGGCTGATAACGG + Intergenic
1182148146 22:28010123-28010145 GGTTGTGTGGAGAATGTGAAGGG - Intronic
1185374699 22:50476929-50476951 GCTTGTGTGCAGGCTGGCAGGGG + Intergenic
1203286528 22_KI270734v1_random:157312-157334 GGTTGTTTCCAGTCTATAAAAGG - Intergenic
950413097 3:12851779-12851801 GGAGGTGTGCTGGCTGTAAAAGG - Intronic
954352196 3:50053992-50054014 TTTTGGGTGCAGACTGTAAATGG + Intronic
959672211 3:108991390-108991412 GGTTGAGTGCAGGATGAGAAAGG + Intronic
966727549 3:183120833-183120855 GGTTGGAAGCAGGCTGGAAAGGG + Intergenic
967533680 3:190577833-190577855 GGTTGGGTGTAGGCTGGACATGG - Intronic
968277400 3:197451057-197451079 GGCTGTGGGCAGGATGCAAAAGG + Intergenic
972912179 4:43831065-43831087 GGTTGTGTGCACGCTTTCTAGGG - Intergenic
985289823 4:188376161-188376183 AGTAGTGTGCAGGGTGTGAAAGG + Intergenic
986317601 5:6600974-6600996 GGGCGTGTGCAGGTTGGAAATGG - Intronic
989297411 5:39846243-39846265 GATTTTGTGCAGGCTGAGAAGGG + Intergenic
989611326 5:43295399-43295421 GGCAGTGTGCAGGATGGAAAAGG + Intronic
989848945 5:46183521-46183543 GATTTTGTCCATGCTGTAAATGG - Intergenic
991037500 5:62142787-62142809 AGTTTTTTGCAGGCTGAAAATGG + Intergenic
999879835 5:155850052-155850074 GGTTGGTTCCTGGCTGTAAAGGG + Intergenic
1000155452 5:158547008-158547030 GGTTGTGTGAGGGTTGTAACTGG - Intergenic
1004437782 6:15613818-15613840 GGTTGTGTGCAGGCTGTAAATGG - Intronic
1004823741 6:19398425-19398447 GGTTGTCTGCAACCTGTAATAGG - Intergenic
1006266115 6:32925696-32925718 GCTTGTATGCAGGCTGGACACGG + Intergenic
1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG + Intergenic
1010208411 6:73343486-73343508 TCTTGTGTGCAGGATATAAAGGG - Intergenic
1011121760 6:83962079-83962101 GGTGGTATGCAGGAAGTAAATGG - Exonic
1013415820 6:109923616-109923638 GGTTGTGTGTAGGGTGGAGAGGG + Intergenic
1014849563 6:126324872-126324894 AGATCTATGCAGGCTGTAAAAGG + Intergenic
1015562004 6:134525897-134525919 GATTGGGTTCAGGTTGTAAAAGG + Intergenic
1016997999 6:149974560-149974582 GGTTCTGTGCAGGCAGGAAGTGG + Intergenic
1017010501 6:150060159-150060181 GGCTGTGTGCAGGCAGGAAGTGG - Intergenic
1018319551 6:162592845-162592867 TGTGGTGTACAAGCTGTAAAAGG + Intronic
1018757715 6:166863957-166863979 GATTTTGTACATGCTGTAAAAGG + Intronic
1024602365 7:50995085-50995107 GGGAGGGTGCAGGCTGTAGAAGG - Intergenic
1025530616 7:61877440-61877462 GTTTGTGTTCATTCTGTAAATGG - Intergenic
1030909628 7:115230395-115230417 GTTTGTGTGCAGGCTATTATAGG + Intergenic
1031068962 7:117141063-117141085 GTTTATGTGCATGCTGTTAAAGG - Intronic
1031155750 7:118109503-118109525 GATTGTGTACAGTCTGTAAGGGG - Intergenic
1031718121 7:125134052-125134074 TGATGTGAACAGGCTGTAAAGGG + Intergenic
1032403729 7:131641104-131641126 GGCTGTGTGAACGCTGCAAAAGG - Intergenic
1037709437 8:21343838-21343860 GGTTGGGGTCAGCCTGTAAAGGG - Intergenic
1038941222 8:32308049-32308071 GGGTGAGTGCAGGTTGAAAATGG - Intronic
1042015131 8:64300724-64300746 GGGTGGATGGAGGCTGTAAAAGG - Intergenic
1046196484 8:110870244-110870266 AGATGTGTGAAGGGTGTAAAAGG - Intergenic
1046628914 8:116604194-116604216 GGCTGTTGGCAGTCTGTAAACGG - Intergenic
1048880742 8:138870561-138870583 TGTGGTGTGCAGACTGTAAATGG + Intronic
1049568506 8:143356334-143356356 GGTCGTGTGTAGGGTGTAGAAGG - Intronic
1049758879 8:144322927-144322949 GGTTGTGGGCAGGCAGTGAGTGG - Intronic
1050576932 9:7006570-7006592 GGTTGTAAGCAGGCTGTGAATGG + Intronic
1053016378 9:34664675-34664697 TGTAGGATGCAGGCTGTAAATGG - Exonic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056826692 9:89880827-89880849 GGCTGTGAGGAGGCTGTGAAAGG + Intergenic
1058644544 9:107118643-107118665 GGTTGTGTACAGGCTGGTACAGG - Intergenic
1059414139 9:114153013-114153035 GGTTGTGAACAGGCAGAAAAGGG + Intergenic
1059974840 9:119704795-119704817 GGATGTGTGCAGGATGGATAGGG - Intergenic
1061589518 9:131589548-131589570 GGCTGTGTGGAGGCTGGAATGGG - Intronic
1062638901 9:137506708-137506730 TGCTGAGGGCAGGCTGTAAAAGG - Intronic
1191262933 X:58347672-58347694 GTTTTTGTCCATGCTGTAAATGG + Intergenic
1191265739 X:58390936-58390958 GTTTTTGTGCATGCTGCAAATGG + Intergenic
1191267853 X:58419730-58419752 GTTTTTGTGTATGCTGTAAATGG - Intergenic
1194643724 X:96432708-96432730 AGTTGTGTGAAGACTCTAAAAGG + Intergenic
1198284086 X:135172532-135172554 GGTTGTGAACAGGCTGGAAGAGG + Intergenic