ID: 1004437824

View in Genome Browser
Species Human (GRCh38)
Location 6:15614089-15614111
Sequence GGTCATGTGTCCTTAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004437824 Original CRISPR GGTCATGTGTCCTTAGAGAT GGG (reversed) Intronic
900574656 1:3377134-3377156 GCTCATGGGTCCTTAAAGAAGGG + Intronic
904937360 1:34141111-34141133 GGTGATGTGACATTTGAGATGGG - Intronic
909059652 1:70865613-70865635 GAGCATGTTTCATTAGAGATAGG + Intronic
911096830 1:94061919-94061941 GCTCATTTGTCATTATAGATGGG - Intronic
915860055 1:159434554-159434576 GGTCATTGGTTCTTAGAGTTGGG - Intergenic
919227737 1:194729523-194729545 TGTCATGGGTCATTAGAGACAGG - Intergenic
919845148 1:201637669-201637691 GAGCATGTGTCCTTCGGGATGGG - Intronic
1066354834 10:34672675-34672697 GGTTATGTGTTTTTAGAAATAGG - Intronic
1070934984 10:80286505-80286527 AGCCAGGTGTCCTTAGAGCTGGG + Intronic
1071130095 10:82380594-82380616 GTTAAGGTGTCATTAGAGATGGG + Intronic
1071330231 10:84551780-84551802 GGCCATCTGTCCATAGAGAACGG + Intergenic
1076369714 10:129944247-129944269 GGTCATTTCTCCTTTCAGATTGG + Intronic
1078566651 11:12420483-12420505 GCTAATGTGTCTTGAGAGATTGG + Intronic
1080069480 11:28063151-28063173 AGTCATGTGATTTTAGAGATGGG + Intronic
1081345833 11:41984673-41984695 GGACAAGTGTCCTTAGACGTAGG + Intergenic
1081619407 11:44610228-44610250 TGACATGTGTCCTTCGAGAGAGG + Intronic
1084499512 11:69526376-69526398 GGGCATCAGTCCTTAGAAATGGG + Intergenic
1085020609 11:73204630-73204652 GGGCATGTGTTCCTAGAGTTGGG - Intergenic
1085316649 11:75549077-75549099 GAACATTTGTCCATAGAGATGGG + Intergenic
1086330902 11:85753209-85753231 GGTTATGTTTCCTTAAAGGTGGG + Intronic
1087008902 11:93495145-93495167 AGTCATGTGACCCTTGAGATGGG - Intronic
1087094271 11:94305189-94305211 GGCCCTGTGTCCTAAGAGGTTGG + Intergenic
1087642960 11:100775076-100775098 GCTCATTTATCCTTAGAGAAGGG - Intronic
1092910643 12:13142019-13142041 GGTTAGGTGTCTTCAGAGATGGG + Intronic
1095943031 12:47738747-47738769 GGTCATGTCTGCAAAGAGATGGG + Exonic
1096408427 12:51360284-51360306 GGGCATGTGTCCTTTGAACTGGG + Intronic
1096973512 12:55685284-55685306 GGCCTGGTGTCCTTATAGATGGG - Exonic
1099518849 12:83633531-83633553 GTTCATGTGTCCTAAGTAATTGG + Intergenic
1099828507 12:87810521-87810543 GGGCATGTGTCCTTATGGTTTGG - Intergenic
1100293723 12:93240914-93240936 GGTCATATGACATCAGAGATTGG + Intergenic
1101831653 12:108262626-108262648 AGGCATGTGTCCTGAGAGAGGGG + Intergenic
1102036911 12:109775818-109775840 GGCTATGTGTCCTTAGTCATGGG + Intergenic
1112086768 13:96040353-96040375 GGCCATGTGAAGTTAGAGATTGG - Intronic
1112155233 13:96809889-96809911 GGTTATGTTTCCATAGAGCTTGG + Intronic
1113034811 13:106037313-106037335 GGGCAGCTGTCCTTAGAGAAAGG - Intergenic
1113468880 13:110530605-110530627 GGTCCTGTGTCTGTAGAGGTGGG - Intronic
1114446814 14:22794913-22794935 GGTCTTGTGTCACTAGAGGTGGG - Intronic
1114928207 14:27432001-27432023 GGTCTTGTGTCCTTTGTGGTAGG - Intergenic
1116321958 14:43479281-43479303 GGTTGTGTGTCCTTAGAGCTTGG - Intergenic
1119350281 14:73958953-73958975 GCTCATGTGTCCATGCAGATAGG + Exonic
1126242897 15:46466066-46466088 GGTCATGGGACCGTAGAGACTGG - Intergenic
1127691804 15:61403911-61403933 GGTCATGTGCCCCCAGAAATTGG - Intergenic
1136239398 16:28934981-28935003 GGACATGGCTCCTTAGAGAGAGG + Intronic
1138835769 16:60432967-60432989 GGTCATATCTCCTTAGAGTAGGG + Intergenic
1141442871 16:84040768-84040790 GGTCATGTGTCTCTGGGGATCGG - Intronic
1143992092 17:10974473-10974495 GTTCCTGTGTCTTCAGAGATAGG - Intergenic
1146311810 17:31775009-31775031 GGTCATGTGTCCTTGTTTATAGG - Intergenic
1156554330 18:38049951-38049973 GGTCATGTGTCTTTAGGGTAAGG + Intergenic
1156962680 18:43051552-43051574 GGACATGTGTGTCTAGAGATCGG + Intronic
1165148924 19:33749795-33749817 GGACATGTGCCCTTAGCTATGGG + Intronic
1168582898 19:57570143-57570165 GGTCAGGTATCCCCAGAGATTGG - Intergenic
928029005 2:27762975-27762997 GGTCATTTTTCCTTAAACATGGG + Intergenic
933155040 2:78963960-78963982 CGTAATGTGTCCTTAGACACTGG - Intergenic
935476268 2:103527643-103527665 GGTTATGTGTCCTTTGAGTATGG + Intergenic
937585923 2:123549597-123549619 AGTCATGTGTCCTTAAATAAGGG + Intergenic
940687239 2:156867930-156867952 TGACATGTATCCTTAGACATGGG - Intergenic
944579645 2:201120683-201120705 AGTCATGTGACTTTAGAAATGGG + Intronic
945995404 2:216432163-216432185 GGGCATGTGCCTGTAGAGATGGG + Intronic
947740957 2:232484714-232484736 GGTCATCTCTCCCCAGAGATGGG - Intronic
1172259459 20:33549887-33549909 AATCAGGTGTCCTGAGAGATTGG + Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175691410 20:61068312-61068334 GGCCATGTGTCCTTGGAAAGGGG - Intergenic
1177342908 21:19827842-19827864 GGTCATTTGTACTAAGAGATAGG - Intergenic
1179099610 21:38345228-38345250 GGCCATCTGTCCATAGAGAGGGG - Intergenic
956140563 3:66142528-66142550 GTTCCTGTGTCCTTAGAGACAGG - Intronic
967286202 3:187872975-187872997 TGACATGTGACCTCAGAGATAGG + Intergenic
968977005 4:3827347-3827369 GGCCGTGTGTCCTTAGGGAGGGG + Intergenic
973118852 4:46492690-46492712 AGTCAAGTGTCCCTAGAGAAAGG + Intergenic
973541778 4:51942068-51942090 GGTCAGGTGGCTTTAGGGATGGG + Intergenic
974036291 4:56821355-56821377 TGGCAGGTGTCCTTAGAGCTGGG + Intronic
976523793 4:86061937-86061959 TGCCATGTGTCCATAGAGAAAGG + Intronic
985928280 5:3034838-3034860 GGTCATGTCTCTATGGAGATGGG + Intergenic
993918755 5:93773763-93773785 GGTAATCTGTGATTAGAGATGGG + Intronic
994206178 5:97038338-97038360 GGTTTTGTGTCCTCAGAAATAGG - Intergenic
995740669 5:115352828-115352850 AGTCATGTGTCCTTAGAACCAGG - Intergenic
995758390 5:115537461-115537483 GGTCCTTTGTCCCTGGAGATTGG - Intronic
996712240 5:126554788-126554810 TGTGATGTTTCCTTAGAGAATGG - Intronic
998568702 5:143238327-143238349 GGGAAGCTGTCCTTAGAGATGGG + Intergenic
1000677177 5:164136135-164136157 GGTCAATGGTCATTAGAGATTGG + Intergenic
1002108317 5:176891282-176891304 GGTCAAGGGGCCATAGAGATGGG + Intronic
1003991576 6:11492059-11492081 AGTCATGTGTCCCAAGAGAAGGG + Intergenic
1004437824 6:15614089-15614111 GGTCATGTGTCCTTAGAGATGGG - Intronic
1005792349 6:29316918-29316940 TGTCATGTGTCTTTAGGGAAAGG - Intergenic
1007051684 6:38837319-38837341 GCTCATATGTCCTCACAGATGGG + Intronic
1010767569 6:79793822-79793844 GGTCATGTGTCCTAAGTTTTTGG + Intergenic
1011500497 6:87983047-87983069 TGTCATCTGTCCTTAGATTTGGG - Intergenic
1014373807 6:120646181-120646203 GGTCTTGCTTTCTTAGAGATTGG - Intergenic
1016499112 6:144698969-144698991 GGTCATTTGTCACTAGACATTGG + Intronic
1018526782 6:164720102-164720124 CGTCATGTGTCATCAGAGAAAGG + Intergenic
1019696595 7:2449804-2449826 GTTCATGTGTCCTCAGACAGTGG + Intergenic
1023937563 7:44750156-44750178 GGTCATGTGTCCTCAGTCCTAGG + Intronic
1024952491 7:54879202-54879224 AGGCATGTGTCCTCAGAGACAGG + Intergenic
1025751000 7:64293831-64293853 GGTCATGTGGCCTAAGGGACTGG + Intergenic
1028247734 7:88502225-88502247 GGTAATGTGTTCTAATAGATGGG + Intergenic
1028466382 7:91157203-91157225 CGTCATGTCTCCTTAGATTTTGG + Intronic
1029035182 7:97512633-97512655 AGTCATGTGTCCTCAGAGTGAGG + Intergenic
1029477640 7:100794413-100794435 GGTCATGGATGCTTAGGGATCGG - Intronic
1031932628 7:127701677-127701699 GGTCATGCTTCATTGGAGATTGG + Intronic
1034531960 7:151701374-151701396 GTGCATGTGACCTTAGACATAGG + Intronic
1037574382 8:20187420-20187442 GGATATGTGTCCATAAAGATAGG + Intergenic
1040902921 8:52435698-52435720 AGTCATGTGTTCTTAATGATGGG - Intronic
1046545969 8:115650448-115650470 GGTCCCATGTCCATAGAGATTGG + Intronic
1047216765 8:122882456-122882478 GGTCATGATTCTTTAGAGAGAGG - Intronic
1050981376 9:12020163-12020185 TGTAATGTGTTCTTAGAGAGGGG - Intergenic
1053318771 9:37076638-37076660 AGTCATGTGTCATTAAAGACTGG + Intergenic
1054944263 9:70778314-70778336 GGTCATGTGTGCTTTGATAAAGG - Intronic
1056118369 9:83462982-83463004 GGTCATGTCTCCTTGGTGGTTGG + Intronic
1060840897 9:126792420-126792442 TCTCATTTGTCCTTAGATATTGG - Intergenic
1061247462 9:129408082-129408104 CTTCAGGTGTCCTTAGAGTTAGG + Intergenic
1061848970 9:133403556-133403578 GGTCAACTGTCCTCAGAGACGGG - Intronic
1185831024 X:3303245-3303267 GGACATGTGTCCATAGATTTAGG - Intergenic
1186426954 X:9469907-9469929 GTTCATGTGTCATCAGAGAGAGG - Intronic
1186534067 X:10329202-10329224 GGTCATTGGACCTCAGAGATGGG + Intergenic
1189076648 X:37922662-37922684 GTTCTTCAGTCCTTAGAGATTGG + Intronic
1189079188 X:37951850-37951872 GGTCAAATTTCCTTAGAGAAAGG + Intronic
1190605691 X:52139725-52139747 GGTCATGGGTCCTTGGAGGCTGG - Intergenic
1193197970 X:78656719-78656741 GGTGATGTTTCCTTAGTTATGGG + Exonic
1193295186 X:79825211-79825233 TGTCATGTGACATTAGAGAAGGG + Intergenic
1194112384 X:89851142-89851164 CATCATGTGTCATTAGAAATTGG + Intergenic
1195245189 X:102988944-102988966 GGTGATGTCTCCCAAGAGATGGG + Intergenic
1197772891 X:130100662-130100684 GGTCATGGGGGCTTAGAGAAGGG - Intronic
1200465038 Y:3505946-3505968 CATCATGTGTCATTAGAAATTGG + Intergenic
1200748085 Y:6920029-6920051 GTTCATGTGTCATCAGAGAGAGG - Intronic