ID: 1004441494

View in Genome Browser
Species Human (GRCh38)
Location 6:15659473-15659495
Sequence CAGAGCTATCACATTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004441494_1004441503 27 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441503 6:15659523-15659545 TTTCTTTCTTTTTTAAGAGATGG No data
1004441494_1004441505 29 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441505 6:15659525-15659547 TCTTTCTTTTTTAAGAGATGGGG No data
1004441494_1004441504 28 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004441494 Original CRISPR CAGAGCTATCACATTGGACC TGG (reversed) Intronic