ID: 1004441494

View in Genome Browser
Species Human (GRCh38)
Location 6:15659473-15659495
Sequence CAGAGCTATCACATTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004441494_1004441503 27 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441503 6:15659523-15659545 TTTCTTTCTTTTTTAAGAGATGG No data
1004441494_1004441504 28 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411
1004441494_1004441505 29 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441505 6:15659525-15659547 TCTTTCTTTTTTAAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004441494 Original CRISPR CAGAGCTATCACATTGGACC TGG (reversed) Intronic
900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG + Intronic
902030122 1:13416246-13416268 CAGAGCAATGACTTTGGCCCTGG + Intronic
912420589 1:109539916-109539938 AGGAGCTATCACATGGGAGCCGG + Exonic
915953310 1:160204664-160204686 GAGAGCTGCCACATTGGGCCTGG + Intergenic
917720919 1:177785700-177785722 GAGAGCTATCACTGTGTACCAGG - Intergenic
920801148 1:209188648-209188670 GAGAGCTATCACTCTGGACCAGG - Intergenic
921968279 1:221116842-221116864 CAGAGGTTTCACATAGCACCTGG - Intergenic
924832551 1:247613593-247613615 CAGAGCAAACACATTTCACCTGG + Intergenic
1063361434 10:5462746-5462768 CAGATCTATCAAGTTAGACCTGG + Intergenic
1067420503 10:46141430-46141452 CAGAGTTGTCACATTAGATCGGG + Intergenic
1067425518 10:46208103-46208125 CAGAGTTGTCACATTAGATCGGG - Intergenic
1067505847 10:46847911-46847933 CAGAGTTGTCACATTAGATCGGG + Intergenic
1068856479 10:61803069-61803091 CAAAGCTAGCACTCTGGACCTGG + Intergenic
1069932239 10:71890610-71890632 CAGAAATGTCACATTGGACTCGG + Intergenic
1072631420 10:97149444-97149466 CATGGCTCTCACATTGAACCGGG + Intronic
1076872239 10:133199795-133199817 CACAGCTTTCCCATCGGACCTGG + Intronic
1078957106 11:16211400-16211422 CATTGCTATCACCTTGGTCCAGG - Intronic
1079116745 11:17645056-17645078 CATAGCTATCAAACTGGACCAGG - Intronic
1083274717 11:61590285-61590307 CAGAGCAATGACCTTGGCCCTGG + Intergenic
1084341383 11:68504644-68504666 CAGGGCTCTCAAATTGTACCAGG - Intronic
1085718115 11:78890659-78890681 CACAGCTTTCACCTTGGACTTGG - Intronic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1091064867 11:132500286-132500308 CAGACCTATCAAATTGGATGAGG - Intronic
1103027821 12:117587975-117587997 TAGAGCTGTAGCATTGGACCTGG - Intronic
1107826548 13:44333522-44333544 CAGAGCCATGAACTTGGACCAGG - Intergenic
1109992694 13:70080195-70080217 GAGTGCTATCTGATTGGACCAGG + Intronic
1110068303 13:71138539-71138561 CACAGCTATCATACTGCACCTGG + Intergenic
1113948911 13:114060402-114060424 CAGACCTGGCACAGTGGACCAGG + Intronic
1118723788 14:68612452-68612474 CAGAGCTGGCCCATAGGACCAGG - Intronic
1126235053 15:46373882-46373904 GAGAGCTATTACATTTGATCAGG - Intergenic
1127683783 15:61322174-61322196 CAGAGCTACCCCACAGGACCAGG - Intergenic
1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG + Intergenic
1138404467 16:56778539-56778561 CTCAGCTACCACATTGGTCCTGG - Intronic
1140997984 16:80279593-80279615 CAGAGCTCCCACAGTGAACCAGG - Intergenic
1143882451 17:10040059-10040081 CTGAGCACTCACTTTGGACCAGG + Intronic
1145177807 17:20716904-20716926 CAGAGCCATCAAATTGTACTGGG + Intergenic
1151104274 17:71594332-71594354 CAGAGCTATCTAATTGTAGCAGG - Intergenic
1155826943 18:30457027-30457049 AAGAGCTCTAACATCGGACCGGG - Intergenic
1160988479 19:1851083-1851105 CAGTGCAATCACCTTGGCCCTGG - Intergenic
1167202038 19:48072562-48072584 CTGAGCTATCACCTTGGAAAAGG + Intronic
926427865 2:12755870-12755892 CTGAGCTTTCACATAGGATCTGG + Intergenic
927865368 2:26584425-26584447 CAGAGCTACCACATCGGGACAGG - Intronic
928600808 2:32901677-32901699 CAGGGCCATCAGAGTGGACCAGG + Intergenic
937261629 2:120590297-120590319 CAGAGTGATCATATTGGCCCTGG + Intergenic
937316109 2:120933071-120933093 CAGAGCTGCCACAGTGGCCCTGG + Intronic
946116404 2:217466356-217466378 CAGAATTATCACATCGGTCCTGG + Intronic
1170635152 20:18098022-18098044 CAGTGCTCTGTCATTGGACCAGG + Intergenic
1175190107 20:57206049-57206071 CCGAGCTGTCAGACTGGACCTGG - Intronic
949539496 3:5020930-5020952 CAGAAATACCACCTTGGACCAGG + Intergenic
953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG + Intronic
959525546 3:107372520-107372542 CAGAGCTGTTGCACTGGACCAGG - Intergenic
961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG + Intronic
962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG + Intergenic
962945949 3:140170873-140170895 CAGAGGATTCACATAGGACCAGG + Intronic
964616274 3:158669742-158669764 CAGAGGTATCTAATTGGGCCTGG + Intronic
965127098 3:164645456-164645478 CAAAGCCATCACATTTTACCTGG + Intergenic
967779503 3:193419858-193419880 CACAGCTATCACTTGGGCCCTGG - Intronic
969997509 4:11328067-11328089 TAAAGTTATCACTTTGGACCAGG - Intergenic
974985511 4:69020371-69020393 AAGAATTATCACATTGCACCAGG - Intronic
985925614 5:3014239-3014261 CAGAGCTATCACTGTGCATCAGG + Intergenic
986364511 5:7017187-7017209 CTGTGTTGTCACATTGGACCTGG + Intergenic
992326384 5:75664154-75664176 TGGAGCTAACACATTGGGCCAGG - Intronic
995562199 5:113394710-113394732 AAGAGCTATCAAATTAGACTGGG - Intronic
995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005975559 6:30795806-30795828 CAGACCTTCCACATTAGACCTGG + Intergenic
1008434372 6:51457685-51457707 AAGAGCTATCACTCTGGACCAGG - Intergenic
1008494465 6:52118598-52118620 CATACCTATCACCTTTGACCTGG + Intergenic
1009883231 6:69595474-69595496 CAGGTCTGTCACAGTGGACCAGG + Intergenic
1013709871 6:112884496-112884518 AAGAGCTATCAGAGTGGAACTGG + Intergenic
1015483630 6:133743721-133743743 TAGAGCTATCAGATGAGACCTGG - Intergenic
1017202477 6:151770823-151770845 CTAATCTATCACATTAGACCTGG + Intronic
1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG + Intergenic
1021333555 7:19369610-19369632 CAGAGACATCATGTTGGACCTGG - Intergenic
1022156698 7:27667751-27667773 CAGAGCTGTCAAACTGGCCCTGG - Intergenic
1023546254 7:41320422-41320444 CAGAGCTCTCACATTATAACTGG + Intergenic
1025295928 7:57775329-57775351 CACAGCCATCACTTTGGACATGG - Intergenic
1026454052 7:70555494-70555516 CAGAGTTACCTCCTTGGACCTGG + Intronic
1032968229 7:137127740-137127762 CAGAGCTATAATCTTGGAGCGGG + Intergenic
1033340933 7:140491729-140491751 TAGAGCTTTCTCAATGGACCTGG + Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1036440344 8:8776228-8776250 CAGTGGGATCACATTAGACCAGG + Intergenic
1039117769 8:34111839-34111861 CAGAGCTGTCTCATTGCACCTGG + Intergenic
1041345242 8:56890292-56890314 CAGAGCTTTCACGTGGGACCGGG - Intergenic
1043923538 8:86011066-86011088 CAGTGCCTTCACATTGGACTTGG + Intronic
1045299440 8:100898592-100898614 GAGAGCCCTCACATTGCACCAGG - Intergenic
1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG + Intergenic
1047101331 8:121679409-121679431 GAGAGCTATCCCTTTGGGCCAGG - Intergenic
1049345914 8:142138551-142138573 CAGGGCTACCACATAGGCCCTGG - Intergenic
1057991337 9:99773480-99773502 CAGAACTATGAGATTGGACATGG - Intergenic
1058760852 9:108130494-108130516 CATAGCTATCTCGTGGGACCCGG + Intergenic
1059298154 9:113290893-113290915 CACAGCTATCACATTGCAACCGG + Exonic
1059505847 9:114799291-114799313 CTGAGCCATCACAATAGACCTGG - Intronic
1060095516 9:120785732-120785754 AAGAGCTATAAAATTGGGCCGGG + Intronic
1060445144 9:123680813-123680835 CAAAGCTATGAGATGGGACCAGG + Intronic
1185523459 X:759170-759192 CAGGGCTAAGACACTGGACCAGG + Intergenic
1192567516 X:72177805-72177827 CAGAGCTCTCACAGTGTTCCAGG + Intergenic
1199544122 X:148989346-148989368 CACAGCCATCACATTGCTCCTGG - Intronic