ID: 1004441504

View in Genome Browser
Species Human (GRCh38)
Location 6:15659524-15659546
Sequence TTCTTTCTTTTTTAAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21276
Summary {0: 2, 1: 56, 2: 870, 3: 3937, 4: 16411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004441494_1004441504 28 Left 1004441494 6:15659473-15659495 CCAGGTCCAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411
1004441498_1004441504 22 Left 1004441498 6:15659479-15659501 CCAATGTGATAGCTCTGGGTGGC 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411
1004441502_1004441504 -6 Left 1004441502 6:15659507-15659529 CCATGTTTTTTCATTTTTTCTTT 0: 1
1: 6
2: 117
3: 2317
4: 39627
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411
1004441501_1004441504 0 Left 1004441501 6:15659501-15659523 CCAGGGCCATGTTTTTTCATTTT 0: 1
1: 0
2: 4
3: 89
4: 1174
Right 1004441504 6:15659524-15659546 TTCTTTCTTTTTTAAGAGATGGG 0: 2
1: 56
2: 870
3: 3937
4: 16411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004441504 Original CRISPR TTCTTTCTTTTTTAAGAGAT GGG Intronic
Too many off-targets to display for this crispr