ID: 1004444124

View in Genome Browser
Species Human (GRCh38)
Location 6:15682165-15682187
Sequence TTGAAGAAACAGGCTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004444124_1004444126 13 Left 1004444124 6:15682165-15682187 CCATTCTGAGCCTGTTTCTTCAA No data
Right 1004444126 6:15682201-15682223 ATAATAACACAGCATCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004444124 Original CRISPR TTGAAGAAACAGGCTCAGAA TGG (reversed) Intergenic
No off target data available for this crispr