ID: 1004457994

View in Genome Browser
Species Human (GRCh38)
Location 6:15809413-15809435
Sequence GACACTTATATTTATACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004457991_1004457994 12 Left 1004457991 6:15809378-15809400 CCTGTAAGTTTTTGACTGTATAG No data
Right 1004457994 6:15809413-15809435 GACACTTATATTTATACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004457994 Original CRISPR GACACTTATATTTATACAAG GGG Intergenic
No off target data available for this crispr