ID: 1004464431

View in Genome Browser
Species Human (GRCh38)
Location 6:15871272-15871294
Sequence CCATTTGTATGGAGCTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004464425_1004464431 -5 Left 1004464425 6:15871254-15871276 CCATGCATTAGATACAACCCATT No data
Right 1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG No data
1004464423_1004464431 11 Left 1004464423 6:15871238-15871260 CCTGAATATCAATTACCCATGCA No data
Right 1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG No data
1004464424_1004464431 -4 Left 1004464424 6:15871253-15871275 CCCATGCATTAGATACAACCCAT No data
Right 1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004464431 Original CRISPR CCATTTGTATGGAGCTCTAG GGG Intergenic
No off target data available for this crispr