ID: 1004466289

View in Genome Browser
Species Human (GRCh38)
Location 6:15888394-15888416
Sequence TATTGACAGACGGTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004466289_1004466293 1 Left 1004466289 6:15888394-15888416 CCCAAAGAAACCGTCTGTCAATA No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data
1004466289_1004466294 10 Left 1004466289 6:15888394-15888416 CCCAAAGAAACCGTCTGTCAATA No data
Right 1004466294 6:15888427-15888449 GGAATGATGACAGGAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004466289 Original CRISPR TATTGACAGACGGTTTCTTT GGG (reversed) Intergenic