ID: 1004466290

View in Genome Browser
Species Human (GRCh38)
Location 6:15888395-15888417
Sequence TTATTGACAGACGGTTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004466290_1004466294 9 Left 1004466290 6:15888395-15888417 CCAAAGAAACCGTCTGTCAATAA No data
Right 1004466294 6:15888427-15888449 GGAATGATGACAGGAGACCATGG No data
1004466290_1004466293 0 Left 1004466290 6:15888395-15888417 CCAAAGAAACCGTCTGTCAATAA No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004466290 Original CRISPR TTATTGACAGACGGTTTCTT TGG (reversed) Intergenic