ID: 1004466290 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:15888395-15888417 |
| Sequence | TTATTGACAGACGGTTTCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1004466290_1004466294 | 9 | Left | 1004466290 | 6:15888395-15888417 | CCAAAGAAACCGTCTGTCAATAA | No data | ||
| Right | 1004466294 | 6:15888427-15888449 | GGAATGATGACAGGAGACCATGG | No data | ||||
| 1004466290_1004466293 | 0 | Left | 1004466290 | 6:15888395-15888417 | CCAAAGAAACCGTCTGTCAATAA | No data | ||
| Right | 1004466293 | 6:15888418-15888440 | GACACATTTGGAATGATGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1004466290 | Original CRISPR | TTATTGACAGACGGTTTCTT TGG (reversed) | Intergenic | ||