ID: 1004466291

View in Genome Browser
Species Human (GRCh38)
Location 6:15888404-15888426
Sequence AAATGTGTCTTATTGACAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004466291_1004466294 0 Left 1004466291 6:15888404-15888426 CCGTCTGTCAATAAGACACATTT No data
Right 1004466294 6:15888427-15888449 GGAATGATGACAGGAGACCATGG No data
1004466291_1004466293 -9 Left 1004466291 6:15888404-15888426 CCGTCTGTCAATAAGACACATTT No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data
1004466291_1004466296 25 Left 1004466291 6:15888404-15888426 CCGTCTGTCAATAAGACACATTT No data
Right 1004466296 6:15888452-15888474 TATTAAACAGTAGAATGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004466291 Original CRISPR AAATGTGTCTTATTGACAGA CGG (reversed) Intergenic