ID: 1004466293

View in Genome Browser
Species Human (GRCh38)
Location 6:15888418-15888440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004466291_1004466293 -9 Left 1004466291 6:15888404-15888426 CCGTCTGTCAATAAGACACATTT No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data
1004466290_1004466293 0 Left 1004466290 6:15888395-15888417 CCAAAGAAACCGTCTGTCAATAA No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data
1004466289_1004466293 1 Left 1004466289 6:15888394-15888416 CCCAAAGAAACCGTCTGTCAATA No data
Right 1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004466293 Original CRISPR GACACATTTGGAATGATGAC AGG Intergenic
No off target data available for this crispr